                                                                        Gene putatively regulated by attenuation in B_anthracis_A2012

This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:138 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-22.40 kcal/mol
Antiterminator: Size=32 nt.     Delta G= -9.71 kcal/mol
Anti-antiterminator:   Size=49 nt.     Delta G= -8.62 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
The T-box sequence: agggtggtaccgcg is shown in italic-bold style

aattacaattctggagcttttttttcgtagtgcttttatgcatgaaggaaaagacggagtttttccgttatcattaattgagatgtaagtatcttttcac
ttacaaatagggtggtaccgcgattctttcgcccctatcggattttccgataggggctttttctatttctcacagaaacaaatgttaaataattccgaat
cttatgataaaattttataagcgcttacaattttgaagggtggtggtacaagctatacgaaaccgatatttaattttacagaaaaaaggaggatgtctaa
ATG

    BA_5025 --- BA_5026 Gene: BA_5025     GI: 21402400     BI number: BA_5025     GOG: COG3186     Description: biopterin_H, Biopterin-dependent aromatic amino acid hydroxylase Gene: BA_5026     GI: 21402401     BI number: BA_5026     GOG: COG2154     Description: Pterin_4a, Pterin 4 alpha carbinolamine dehydratas tt c  t t  t a  c ta gc at         c at       t  t ta       t  t gc        at ta        gc a  a       cg g  a       gc         t a  t      c  |      t  t g  a      c  |      a  t t  g      a  |       gc t  |      t  |       gc a  |      g  |       cg a  |      g  |       ta tg       t  |       at tg        gc        ta at        gc        cg cg        gc        cg tg        at        cg at        ta        cg ta        at        gc                         tttttctatttctcacagaaacaaatgttaaataattccgaatcttatgataaaattttataagcgcttacaattttgaagggtggtggtacaagctatacgaaaccgatatttaattttacagaaaaaaggaggatgtctaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG3186 Phenylalanine-4-hydroxylase ... can be seen here [H] COG2154 Pterin-4a-carbinolamine dehydratase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here     ..................................................................................................................