                                                                        Gene putatively regulated by attenuation in B_anthracis_A2012

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:105 nt.    Distance to gene:79 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G=-10.60 kcal/mol
Antiterminator:    Distance from promoter:76 nt. Size=40 nt.     Delta G= -3.40 kcal/mol
Anti-antiterminator:    Distance from promoter:70 nt.    Size=21 nt.     Delta G= -3.10 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGCGT-TATGAT. It has a score value of 64.26 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGCGTTATATACGTTTCATAATATGATGTTTATGGATGGTTCATTAAGAAAAGTAGG
CTTGTTTATTCTATTTTATATCGCTGCATGCATCATGTATTTCTTTTTCGCTCAAAGA
GAATATAGGGAACATTTAGACTAGcgaatgctagtcttttttaaatattcaaaatttacatagaagaatataaaaaagtatg
gtataacagtaagaaaacgaaaaagaggggaaaagacgATG

    BA_5105 Gene: BA_5105     GI: 21402480     BI number: BA_5105     GOG: COG0077     Description: PDT, Prephenate dehydratas            GG           A  G           T  A           A  A           T  C           A  A            AT            GT            AT   C       G  A G  T      A  G       aa C  C      A  A      g  t TA       A  C       cg TA       C  T       Gc TA        TA        At TG        CG        Ta TA        Gc        Cg CG        Cg        At TA        Ta        Gc TA        Ta        At                         tttttaaatattcaaaatttacatagaagaatataaaaaagtatggtataacagtaagaaaacgaaaaagaggggaaaagacgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0077 Prephenate dehydratase ... can be seen here     ..................................................................................................................