Gene putatively regulated by attenuation in B_anthracis_A2012

This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:16 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-24.80 kcal/mol
Antiterminator: Size=31 nt.     Delta G= -4.60 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G=-13.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
The T-box sequence: aaggtggtaccgcg is shown in italic-bold style

cactattgtatataataattaacaatcatataaatgccttgaaggggaagagtataacaagaaacgtcttcagagaggagaatcattagctgggagattc
tctagatagttatgttagaaggtagccctggagcatcttttctgaacggaatagttctcattaggaaaagacggatttgtccgttatcaagttaagagta
taagcaaattcctggatttgtttgtaaataaaggtggtaccgcgatgtccctcgtccttttttggatgagggacattttttattttaaggagggaaaata
ATG

    BA_5129


Gene: BA_5129     GI: 21402504     BI number: BA_5129     GOG: COG0525     Description: tRNA-synt_1, tRNA synthetases class I (I, L, M and V


 ct
c  g
 tg
 ta
 at
 at
 at
 cg
 gt
 at
 at
 tg
 at        cg        tt
 ta       g  a      t  t
g  a      c  t      t  t
a  a       cg        cg
g  |       at        cg
a  |      t  c       ta
 at        gc        gt
 ta        gc        cg
 ta       |  t       ta
|  a      |  c       cg
g  g      |  g       cg
a  g      t  t       cg
 at        gc        ta
 cg        gc        gc
 tg        at        ta
 at        at        at
 ta        at        gt
                        ttttattttaaggagggaaaataATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[J] COG0525 Valyl-tRNA synthetase ... can be seen here

                                                                        Genes that have a predicted attenuator with a riboswitch:

Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here

    ..................................................................................................................