Gene putatively regulated by attenuation in B_anthracis_A2012

This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:94 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-20.50 kcal/mol
Antiterminator: Size=34 nt.     Delta G= -4.91 kcal/mol
Anti-antiterminator:   Size=23 nt.     Delta G= -1.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
The T-box sequence: agggtggaaccacg is shown in italic-bold style

cttcctaatacggaaagacgaacttaccacctctaaacttcaagagtgaactgcatgcataatgcattgtaattcttggcggataaaaccgttatcaatt
tacacgagctataaaatgagcttatttcgttataaattcattttattagaataagggtggaaccacgatttcaacactcgtccctttgttagggacgggt
gttttttgcgttcttttacggggaagtatgcttgaaagaggatatatgacggattttaattcagaatattttgttaaattaaattaggaggttagtagaa
ATG

    BA_5218


Gene: BA_5218     GI: 21402593     BI number: BA_5218     GOG: COG1114     Description: hypothetical protein predicted by GeneMar


            a
          c  a
          t  c
          t  a
          t  c
           at
           gc         g
           cg       t  t
           at       t  t
  g       c  |       ta
g  a      c  |       cg
t  a      a  |       cg
 gc       a  |       cg
 gc       g  |       ta
g  a      g  |       gc
a  c      t  |       cg
a  g       gc        tg
 ta        gc        cg
 at        gc        at
 at        at        cg
 gt        at        at
                        tttttgcgttcttttacggggaagtatgcttgaaagaggatatatgacggattttaattcagaatattttgttaaattaaattaggaggttagtagaaATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[E] COG1114 Branched-chain amino acid permeases ... can be seen here

                                                                        Genes that have a predicted attenuator with a riboswitch:

Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here

    ..................................................................................................................