                                                                        Gene putatively regulated by attenuation in B_anthracis_A2012

This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:34 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-16.10 kcal/mol
Antiterminator: Size=38 nt.     Delta G= -5.10 kcal/mol
Anti-antiterminator:   Size=48 nt.     Delta G= -7.52 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
The T-box sequence: tgggtggtaccgcg is shown in italic-bold style

agacgatgataaggaaaagtagtatatactataatccaaagcgagtcagggacggtgagagcctgatgaggcggtatatgtgaagaacaccttggagttg
ctaaccgaaattgaatcttgtattcaagagtagacttagacgggaatccggcctgttacaaaccgggaagtatgtattacatacgagttaaagttggtct
ttatgacaaattgggtggtaccgcgaagtttaacctttcgtccctttatggatgaaaggtttttttgtatttaaatatatcagcaaaggagaacttcact
ATG

    BA_5227 Gene: BA_5227     GI: 21402602     BI number: BA_5227     GOG: COG0017     Description: tRNA-synt_2, tRNA synthetases class II (D, K and N   t t  a t  t cg ta gc g  a t  a t  a g  |       cg a  |      g  a a  |      c  a a  |       cg t  |       at t  |      t  t       tt g  |      g  t      t  a at       g  a      c  t gt        ta        cg cg        gc        cg a  g       gc        ta t  |       gt        gt a  |      t  t       cg cg       t  t       ta at       a  c       ta tg       a  |       ta tg       a  |       cg at        cg        cg ta        at        at gc        gc        at                         tttttgtatttaaatatatcagcaaaggagaacttcactATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0017 Aspartyl/asparaginyl-tRNA synthetases ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here     ..................................................................................................................