                                                                        Gene putatively regulated by attenuation in B_anthracis_A2012

This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:25 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-18.70 kcal/mol
Antiterminator: Size=36 nt.     Delta G= -7.26 kcal/mol
Anti-antiterminator:   Size=54 nt.     Delta G=-10.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
The T-box sequence: agggtggaaccacg is shown in italic-bold style

aattacctacataaatgaaatatattgaaatgtcatgatgaggacatgagtagttttctacgattttcagagagggaagccttagggtgtgagcttccta
gtacgggattattacttaccacctctaaactttagcagtgaacggttttctagtaattgctaacggacaacaccgttatgttgaacttgagcaattaaca
ataaggttaattggaacaagggtggaaccacgaattcaacactcgtccctttttacgggatgagtgttttttattttgagaaaaagaggagtgaccagtg
ATG

    BA_5245 Gene: BA_5245     GI: 21402620     BI number: BA_5245     GOG: COG0441     Description: tRNA-synt_2b, tRNA synthetase class II core domain (G, H, P, S and T ta a  a a  g cg at at ta ta at at cg |  g g  a a  a        g gc       c  a ta       a  a ta       c  t cg       c  t        t a  |      a  c      t  t a  |      a  a      t  a g  |      g  a      t  c t  |       gc        cg t  |       ta        cg g  |       gc        cg t  |       gt        ta a  |       gc        gt t  |      a  g       cg t  |      a  |       ta g  |      c  |       cg cg       a  |       at cg        at        cg at        gc        at cg        gc        at                         ttttattttgagaaaaagaggagtgaccagtgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0441 Threonyl-tRNA synthetase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_anthracis_A2012 This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:32 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G=-11.80 kcal/mol Antiterminator: Size=36 nt.     Delta G= -7.26 kcal/mol Anti-antiterminator:   Size=33 nt.     Delta G= -5.60 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case The T-box sequence: agggtggaaccacg is shown in italic-bold style aattacctacataaatgaaatatattgaaatgtcatgatgaggacatgagtagttttctacgattttcagagagggaagccttagggtgtgagcttccta gtacgggattattacttaccacctctaaactttagcagtgaacggttttctagtaattgctaacggacaacaccgttatgttgaacttgagcaattaaca ataaggttaattggaacaagggtggaaccacgaattcaacactcgtccctttttacgggatgagtgttttttattttgagaaaaagaggagtgaccagtg ATG     BA_5245 Gene: BA_5245     GI: 21402620     BI number: BA_5245     GOG: COG0441     Description: tRNA-synt_2b, tRNA synthetase class II core domain (G, H, P, S and T             t           g  g           g  g ta       g  a a  a      a  a a  g      a  c cg       c  c at       a  a at        ac         t ta        gg       t  t ta        ga       t  a at        ta       t  c at        tt        cg cg       a  t       cg |  g      a  |       cg g  a      t  |       ta a  a      t  |       gt gc        gc        cg ta        ga        ta ta        aa        cg                         tgttttttattttgagaaaaagaggagtgaccagtgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0441 Threonyl-tRNA synthetase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here     ..................................................................................................................