                                                                        Gene putatively regulated by attenuation in B_anthracis_A2012

This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:51 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-15.80 kcal/mol
Antiterminator: Size=32 nt.     Delta G= -6.11 kcal/mol
Anti-antiterminator:   Size=10 nt.     Delta G= -0.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
The T-box sequence: agggtggtaacgcg is shown in italic-bold style

aattgagcgtggaaagggagaagtagtgatcatttccctgttttagagagctgatggccggtgaaaatcagcacatagatgatcgcgaattacgccccta
gagcatcttttttcgattgaattgtattcaaaagggaagagacggtgctaagccgttatgtaaataaggtggtaggctttttttggtctgcaactagggtggtaacgcgataatcaaaatcgtcccttatttgaaggggcgatttttttatgtttttaaccttcacgccagtaatgaacttaaaggagagtatgtaggat
ATG

    BA_5330 Gene: BA_5330     GI: 21402705     BI number: BA_5330     GOG: COG0162     Description: tRNA-synt_1b, tRNA synthetases class I (W and Y         c       t  a       a  a       a  a        ta        at         t        gc       t  t        cg       a  g        gt        ta       c  |       ta       a  |       cg       a  |       cg       t  |       cg       g  |       tg       g  |       gc       t  |       cg        gc        ta        gc        at        gc        at        at        at                         ttttatgtttttaaccttcacgccagtaatgaacttaaaggagagtatgtaggatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0162 Tyrosyl-tRNA synthetase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here     ..................................................................................................................