                                                                        Gene putatively regulated by attenuation in B_anthracis_A2012

This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:41 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-24.00 kcal/mol
Antiterminator: Size=37 nt.     Delta G= -8.01 kcal/mol
Anti-antiterminator:   Size=50 nt.     Delta G=-11.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
The T-box sequence: agggtggtaccgcg is shown in italic-bold style

taactcatatttgtaataacagtgagaaggagtagtagtaatagaagctggtttagagagttgacggtcggtgcaagtcaatccacgtttcgttatgaac
tcgcctttgagttgcagttgtgaaactaatagtagcaattgccgttaatccacgttacggatctaagcgaatgtatattttttgtacattaatttagggtggtaccgcgggaatctataacctctcgtccctttctagggatgagaggttttttgtattttgggcggtgaaaataaatagaattttaaggagggtatctc
ATG

    BA_5411 Gene: BA_5411     GI: 21402786     BI number: BA_5411     GOG: COG0495     Description: tRNA-synt_1, tRNA synthetases class I (I, L, M and V   t t  t t  t at tg at ta        at gc       t  a ta       c  a at       t  c at       a  c g  a       at c  a       gc        tc gt        gt       t  t at        gc        ta at        cg        cg ta        gt        cg cg       c  |       cg tg       c  |       ta |  g      a  |       gt |  t      t  |       cg |  g      g  |       ta |  g      g  |       cg |  t      t  |       ta a  a       gc        cg gc        gc        cg gc        gc        at cg        at        at                         ttttgtattttgggcggtgaaaataaatagaattttaaggagggtatctcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0495 Leucyl-tRNA synthetase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_anthracis_A2012 This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:48 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-21.40 kcal/mol Antiterminator: Size=37 nt.     Delta G= -8.01 kcal/mol Anti-antiterminator:   Size=55 nt.     Delta G=-13.60 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case The T-box sequence: agggtggtaccgcg is shown in italic-bold style taactcatatttgtaataacagtgagaaggagtagtagtaatagaagctggtttagagagttgacggtcggtgcaagtcaatccacgtttcgttatgaac tcgcctttgagttgcagttgtgaaactaatagtagcaattgccgttaatccacgttacggatctaagcgaatgtatattttttgtacattaatttagggt ggtaccgcgggaatctataacctctcgtccctttctagggatgagaggttttttgtattttgggcggtgaaaataaatagaattttaaggagggtatctc ATG     BA_5411 Gene: BA_5411     GI: 21402786     BI number: BA_5411     GOG: COG0495     Description: tRNA-synt_1, tRNA synthetases class I (I, L, M and V   t t  t t  t at tg at ta        cg gc       g  g ta       c  g at       c  a at       a  a g  a       tt c  a       gc gt        gt at        ta        tc at        gt       t  t ta        ga        ta cg       g  |       cg tg       a  |       cg a  g      t  |       cg g  t      t  |       ta g  g      t  |       gt cg       a  |       cg at       a  |       ta ta        ta        cg t  c       tc        ta gc        ac        cg cg        ct        cg                         ttttttgtattttgggcggtgaaaataaatagaattttaaggagggtatctcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0495 Leucyl-tRNA synthetase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here     ..................................................................................................................