                                                                        Gene putatively regulated by attenuation in B_anthracis_A2012

This operon is putativelly rgulated by Methionine_S-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:100 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-12.50 kcal/mol
Antiterminator: Size=42 nt.     Delta G= -5.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

acggatactctcttatcccgagctggcggagggacaggcccgatgaagcccagcaacctcacttgtagtggtaaatacaggtgaataggtgctaaaacct
gtgcgaggctacaggtctcgaacgataagagcgaagggcaaaaagcagtatgcaagtagcaaattaaacctttcctctatataaagtaggaaaggttttt
ctgtatgcttgtgtgggagaataaatgtatgtcgcaatctgtggcaaattaaggatgagttccgtacaatatatacaattactgtagggaggtttaccac
ATG

    BA_5437 Gene: BA_5437     GI: 21402812     BI number: BA_5437     GOG: COG0192     Description: S-AdoMet_syntD3, S-adenosylmethionine synthetase, C-terminal domai   g a  t a  a cg gc ta a  a ta gt at        at c  a      t  a g  a      a  a a  a       ta a  |       cg a  |      |  t a  |       ta a  |       cg c  |       cg gc        ta gc        ta gt        ta at        cg at        cg gc        at             ttttctgtatgcttgtgtgggagaataaatgtatgtcgcaatctgtggcaaattaaggatgagttccgtacaatatatacaattactgtagggaggtttaccacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG0192 S-adenosylmethionine synthetase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Methionine_S-box sequence ... can be seen here     ..................................................................................................................