Gene putatively regulated by attenuation in B_anthracis_A2012_pl-pXO1

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:87 nt.    Distance to gene:68 nt.     Distance to run of Ts=0 nt.   Size=40 nt.     Delta G=-31.80 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGATA-CCCAAT. It has a score value of 60.24 and is shown in blue

TTGATATAGTACAAGTGTAGGAACCCAATCAATTGGAGTATATAGGTGCATaagattctcca
aacatttctttagaacgctattgtctcctatgcaatgtatttcacagaactaagcttcattcctcccacttctttagaggtgggaggaatgaagtgtttt
tttctttatagaacatacgtttatattgtataatataaataattaaaaagaaaggagtgacgggcaATG

    BXA0029


Gene: BXA0029     GI: 21392716     BI number: GeneID:1158589     GOG: -------     Description: hypothetical protein, (pXO1-20


          tt
         t  a
          cg
          ta
          tg
          cg
          at
          cg
          cg
          cg
          ta
          cg
          cg
          ta
          ta
          at
          cg
          ta
          ta
          cg
            tgtttttttctttatagaacatacgtttatattgtataatataaataattaaaaagaaaggagtgacgggcaATG


    ..................................................................................................................