                                                                        Gene putatively regulated by attenuation in B_anthracis_A2012_pl-pXO1

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:42 nt.    Distance to gene:21 nt.     Distance to run of Ts=1 nt.   Size=37 nt.     Delta G=-16.90 kcal/mol
Antiterminator:    Distance from promoter:32 nt. Size=24 nt.     Delta G= -7.00 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgcat-tatatt. It has a score value of 81.66 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgcatttaagcagaaataccattatatttgtattaacaactatataaataaatcataatttacgtgaaggacacaccttacgtaccatcccaacggtac
aggtgtgtccttttttacgttctaggaggaaaatataATG

    BXA0046 --- BXA0045 Gene: BXA0046     GI: 21392733     BI number: GeneID:1158606     GOG: -------     Description: hypothetical protein, (pXO1-32) Gene: BXA0045     GI: 21392732     BI number: GeneID:1158605     GOG: -------     Description: hypothetical protein, (pXO1-31            cc           c  a           t  a           a  c            cg            cg            at   a        ta c  c       gc a  a      c  | gc       a  | gc       t  | a  |       ta at        cg gt        cg ta        at gc        cg cg        at at        cg ta        at             ccttttttacgttctaggaggaaaatataATG     ..................................................................................................................