Gene putatively regulated by attenuation in B_anthracis_A2012_pl-pXO1

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:65 nt.    Distance to gene:34 nt.     Distance to run of Ts=0 nt.   Size=37 nt.     Delta G=-23.30 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgact-tattct. It has a score value of 84.34 and is shown in blue

ttgacttttaaaattcatagaggtattcttatacgtgagcaacaattaatcaagagaaatatacaaattaatagatttaatttctagctaaacggacaca
ccgaaggcacataacctgccatcggtgtgtctttttttgtataaataacaagaaaagggagaatttgaaactATG

    BXA0075 --- BXA0076 --- BXA0077 --- BXA0078


Gene: BXA0075     GI: 21392761     BI number: GeneID:1158635     GOG: -------     Description: hypothetical protein, (pXO1-50)
Gene: BXA0076     GI: 21392762     BI number: GeneID:1158636     GOG: -------     Description: hypothetical protein, (pXO1-51)
Gene: BXA0077     GI: 21392763     BI number: GeneID:1158637     GOG: -------     Description: hypothetical protein, (pXO1-52)
Gene: BXA0078     GI: 21392764     BI number: GeneID:1158638     GOG: -------     Description: hypothetical protein, (pXO1-53


           a
         t  a
         a  c
         c  c
          at
          cg
          gc
          gc
         a  a
          at
          gc
          cg
          cg
          at
          cg
          at
          cg
          at
          gc
            tttttttgtataaataacaagaaaagggagaatttgaaactATG
    ..................................................................................................................