Gene putatively regulated by attenuation in B_anthracis_A2012_pl-pXO1

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:62 nt.    Distance to gene:35 nt.     Distance to run of Ts=0 nt.   Size=39 nt.     Delta G=-26.30 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaca-taatat. It has a score value of 85.68 and is shown in blue

ttgacatgaaactctatatatcataatattgaaattgtaatattaaagaaatcaaatccaacattttcatatagactttagattagctaaaaggacacac
ctaaggcgcattatgccataggtgtgtcctttttttgcgtttaaaggctacataaggaggaatacaaacaTTG

    BXA0083


Gene: BXA0083     GI: 21392769     BI number: GeneID:1158643     GOG: -------     Description: hypothetical protein, (pXO1-57


           t
         a  t
         c  a
          gt
          cg
          gc
          gc
         a  a
          at
          ta
          cg
          cg
          at
          cg
          at
          cg
          at
          gc
          gc
          at
            ttttttgcgtttaaaggctacataaggaggaatacaaacaTTG


    ..................................................................................................................