Gene putatively regulated by attenuation in B_anthracis_A2012_pl-pXO1

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:114 nt.    Distance to gene:116 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-12.00 kcal/mol
Antiterminator:    Distance from promoter:51 nt. Size=69 nt.     Delta G=-13.83 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAAG-TAAACT. It has a score value of 62.25 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAAGTTTTAATTCAACAGGTAAACTTCTTAGAACCACGACAATTTAAAGTGCAGGT
AAACAAATATGCACAAATTGTAACACCAATTGCACAAATTCCACATGGACAAGAAGAA
GTACCTGTGGATTAAgaaaaaatgagggttgtggaagaaaaaacacaacccttttataaaaaagaaagagtacctaaatttatttattg
aatattcataattttctgatataataaaccatagttaaatgaaatttgtatatagcgctaaaatgaatatggaggaatacaaATG

    BXA0113 --- BXA0114


Gene: BXA0113     GI: 21392797     BI number: GeneID:1158672     GOG: -------     Description: hypothetical protein, (pXO1-83)
Gene: BXA0114     GI: 21392798     BI number: GeneID:1158673     GOG: -------     Description: conserved hypothetical protein, (pXO1-84


 AA
G  G
A  A
A  A
 CG
 AT
|  A
 GC
 GC
T  |
 AT
 CG
 AT
 CG
 CG
 TA
|  T
T  T
A  A
A  A
A  g
C  a
A  a
C  a
G  a       aa
 Ta       g  a
 Ta       a  a
 At       a  a
|  g      g  a
A  a       gc
 Cg        ta
 Cg        gc
A  |       ta
 Cg        ta
 At        gc
 At        gc
 Tg        gc
            ttttataaaaaagaaagagtacctaaatttatttattgaatattcataattttctgatataataaaccatagttaaatgaaatttgtatatagcgctaaaatgaatatggaggaatacaaATG


    ..................................................................................................................