                                                                        Gene putatively regulated by attenuation in B_anthracis_A2012_pl-pXO1

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:113 nt.    Distance to gene:86 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-19.40 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: CGGATT-TATATT. It has a score value of 60.91 and is shown in blue

CGGATTTGAAATAGGTACTTGCCTATATTGCGAGCATCCTAATCATGTAGGGAAATGT
ATGAAATGTGGAAAAATATTGAATTCCCCTACGGATAAAGTATGTGATGAGTGTTGGG
AAGAAATCAAGGAAGATTAAtatttcagataaaagttgcaactattgttgtaacttttatcttttttaggaacggatattttcaa
atgataaccattaatgaaataatgatatggtataattttcataatatatatgcaaagaagggatggaATG

    BXA0190 --- BXA0191 Gene: BXA0190     GI: 21392866     BI number: GeneID:1158749     GOG: -------     Description: hypothetical protein, (pXO1-98) Gene: BXA0191     GI: 21392867     BI number: GeneID:1158750     GOG: -------     Description: conserved hypothetical protein, (pXO1-97           at          t  t           cg           at           at           cg           gt           ta           ta           gc           at           at           at           at           ta           at           gc           at             tttttaggaacggatattttcaaatgataaccattaatgaaataatgatatggtataattttcataatatatatgcaaagaagggatggaATG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_anthracis_A2012_pl-pXO1                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:121 nt.    Distance to gene:94 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G= -8.20 kcal/mol Antiterminator:    Distance from promoter:83 nt. Size=63 nt.     Delta G=-10.60 kcal/mol Anti-antiterminator:    Distance from promoter:42 nt.    Size=70 nt.     Delta G= -7.00 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: CGGATT-TATATT. It has a score value of 60.91 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case CGGATTTGAAATAGGTACTTGCCTATATTGCGAGCATCCTAATCATGTAGGGAAATGT ATGAAATGTGGAAAAATATTGAATTCCCCTACGGATAAAGTATGTGATGAGTGTTGGG AAGAAATCAAGGAAGATTAAtatttcagataaaagttgcaactattgttgtaacttttatcttttttaggaacggatattttcaa atgataaccattaatgaaataatgatatggtataattttcataatatatatgcaaagaagggatggaATG     BXA0190 --- BXA0191 Gene: BXA0190     GI: 21392866     BI number: GeneID:1158749     GOG: -------     Description: hypothetical protein, (pXO1-98) Gene: BXA0191     GI: 21392867     BI number: GeneID:1158750     GOG: -------     Description: conserved hypothetical protein, (pXO1-97   G T  T A  G TA GT |  G A  A A  G AT TG AT        ag GT       c  a G  |      t  t C  |       ta A  |       ta TG        aa CG        ta CG       |  g |  A      |  t |  A      A  t |  G      A  g |  A       Tc |  A       Ta |  A       Aa |  T       Gc |  C      A  t |  A       Aa |  A       Gt CG        Gt CG        A TA       A TA       C |  G      T A  A       A        at AT        A       t  t GT       A         cg TA       G         at TA        A        at At        A        cg Ta       G  |       gt At        G        ta At        G        ta At        T        gc                         ttttatcttttttaggaacggatattttcaaatgataaccattaatgaaataatgatatggtataattttcataatatatatgcaaagaagggatggaATG     ..................................................................................................................