Gene putatively regulated by attenuation in B_anthracis_A2012_pl-pXO1

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:36 nt.    Distance to gene:37 nt.     Distance to run of Ts=0 nt.   Size=39 nt.     Delta G=-19.90 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaaa-tataat. It has a score value of 78.31 and is shown in blue

ttgaaagtatttgtaaattacattataataatggtaattaaacatatcattacccacatacaaaaggacaaacctacgtatccctaccagggcgaggttt
gtccttttttcattttaataaacacttaacaagtggaggattaaacATG

    BXA0025


Gene: BXA0025     GI: 21392892     BI number: GeneID:1158778     GOG: -------     Description: hypothetical protein, (pXO1-17


           c
         a  c
         t  a
          cg
          cg
          cg
         t  |
         a  |
         t  |
          gc
          cg
         a  |
          ta
          cg
          cg
          at
          at
          at
          cg
          at
          gc
          gc
            ttttttcattttaataaacacttaacaagtggaggattaaacATG
    ..................................................................................................................