                                                                        Gene putatively regulated by attenuation in B_anthracis_A2012_pl-pXO2

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:146 nt.    Distance to gene:9 nt.     Distance to run of Ts=1 nt.   Size=26 nt.     Delta G=-12.40 kcal/mol
Antiterminator:    Distance from promoter:117 nt. Size=39 nt.     Delta G= -8.80 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAGA-CAAAAT. It has a score value of 62.92 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAGAGGATGTTGTAACATGTTAGATCAAAATACGGATCGTAGTTGGTGGATGATTG
GTGCAGTTGTTGTAGGTGCTGCTTTAGTAGGGGTTGTTTCTGTTGCTTTTCCTGACTT
AACGCACTCAGTAATCAATGTATTTACAGACAAACTTTCCTCAGTTAAATAAttatatcca
acaaggggagagagaattttctctccttatttgtttgggaaggaGTG

    BXB0024 --- BXB0023 --- BXB0022 --- BXB0021 --- BXB0020 --- BXB0019 --- BXB0018 --- BXB0017 Gene: BXB0024     GI: 21392916     BI number: GeneID:1158801     GOG: -------     Description: hypothetical protein, (pXO2-26) Gene: BXB0023     GI: 21392915     BI number: GeneID:1158800     GOG: -------     Description: bacterial type II/IV secretion system protein, (pXO2-25) Gene: BXB0022     GI: 21392914     BI number: GeneID:1158799     GOG: -------     Description: hypothetical protein, (pXO2-24/23) Gene: BXB0021     GI: 21392913     BI number: GeneID:1158798     GOG: -------     Description: hypothetical protein, (pXO2-22) Gene: BXB0020     GI: 21392912     BI number: GeneID:1158797     GOG: -------     Description: hypothetical protein, (pXO2-21) Gene: BXB0019     GI: 21392996     BI number: GeneID:1158888     GOG: -------     Description: hypothetical protein, (pXO2-20) Gene: BXB0018     GI: 21392911     BI number: GeneID:1158796     GOG: -------     Description: hypothetical protein, (pXO2-19) Gene: BXB0017     GI: 21392910     BI number: GeneID:1158795     GOG: -------     Description: hypothetical protein, (pXO2-18 tt A  a At Ta At A  c A  c Ta        aa Ta       g  t Gc        at |  a       gt A  a       at Cg        gc Tg        at Cg        gc Cg        gt Ta        gc Tg        gc Ta        at Cg        at             atttgtttgggaaggaGTG     ..................................................................................................................