                                                                        Gene putatively regulated by attenuation in B_anthracis_A2012_pl-pXO2

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:178 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-17.00 kcal/mol
Antiterminator: Size=41 nt.     Delta G= -7.80 kcal/mol
Anti-antiterminator:   Size=38 nt.     Delta G=-11.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TATTTAAGAGAATGCCGTAAATGCGGCATGAAGAAAAGTATCTAGccccgcatgggcttttttcttt
ataaaaaaaagtagaaaaagtcgatttcctatacattaggggaatcgactttttgttgttaattgatagttgttgctttaagtattggatatgcattatt
tcatatttgagaagttcgatttatcgacattttacgacaagatttatagtatcattatgctaagatactatatgctaatattccgctaaatgaatgttgg
tggggggaatccttaaattaaggggcaatttgtATG

    BXB0036 --- BXB0035 --- BXB0034 Gene: BXB0036     GI: 21392928     BI number: GeneID:1158813     GOG: -------     Description: hypothetical protein, (pXO2-36) Gene: BXB0035     GI: 21392927     BI number: GeneID:1158812     GOG: -------     Description: conserved hypothetical protein, (pXO2-35) Gene: BXB0034     GI: 21392926     BI number: GeneID:1158811     GOG: -------     Description: hypothetical protei   c         a g  a      a  a c  t      t  a cg       a  a cg        ta cg        ta        ca Gc        ta       a  t At        cg       t  t T  |      |  t      a  a C  |      |  a       tg T  |       tg        cg A  |       ta        cg T  |       ta        tg Gt        ta        ta At        ta        ta At        ta        at At        cg        gc At        gt        cg Gc        gc        ta At       g  g       gc At        ta        at Gt        at        at                         tttgttgttaattgatagttgttgctttaagtattggatatgcattatttcatatttgagaagttcgatttatcgacattttacgacaagatttatagtatcattatgctaagatactatatgctaatattccgctaaatgaatgttggtggggggaatccttaaattaaggggcaatttgtATG     ..................................................................................................................