Gene putatively regulated by attenuation in B_anthracis_A2012_pl-pXO2

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:114 nt.    Distance to gene:31 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-19.20 kcal/mol
Antiterminator:    Distance from promoter:79 nt. Size=39 nt.     Delta G= -4.10 kcal/mol
Anti-antiterminator:    Distance from promoter:40 nt.    Size=57 nt.     Delta G= -6.53 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaga-tagtat. It has a score value of 77.64 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgagatataaaatatctcttcttagtatagttaattagagtagatttgtaaagatagaaacccttatttaagtgcatttttaggcatggttaagtatgg
atttttctgcctttatatataatttagggaagtctatttatctaggtgagcagtgatatagctgctcacctttttttgttgtcaaaaatcagtggaaagg
aggttcaacATG

    BXB0039


Gene: BXB0039     GI: 21392931     BI number: GeneID:1158816     GOG: -------     Description: plasmid replication protein, (pXO2-38


  t
a  g
t  g
g  a
 at
 at
t  t
t  t
 gt
 gc
t  |       gg
 at       a  g
 cg        ta
 gc        ta
 gc        tg
 at        at
|  t      |  c       ta
t  t       at       a  t
t  a       ta       g  a
t  t       at        tg
t  a      t  t       gc
t  t       at        at
a  a       ta        cg
c  t       at        gc
g  a      t  c       at
 ta       t  t       gc
 gt        ta        ta
 at        cg        gc
 at        cg        gc
 ta        gt        at
                        ttttttgttgtcaaaaatcagtggaaaggaggttcaacATG


    ..................................................................................................................