Gene putatively regulated by attenuation in B_anthracis_A2012_pl-pXO2

This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:56 nt.    Distance to gene:102 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G=-15.40 kcal/mol
Antiterminator:    Distance from promoter:25 nt. Size=44 nt.     Delta G= -7.50 kcal/mol
Anti-antiterminator:   Size=60 nt.     Delta G= -9.94 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgtga-taccgt. It has a score value of 70.95 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
The T-box sequence: agggtggtaccgcg is shown in italic-bold style

ttgtgatgaaagacggtagtttataccgttaacaaatagagtggtgaagtttcttcacaactagggtggtaccgcgatcatttatcgtccctacatgatg
tagggacgttttttgttgtcaaaattaaaaacttaagtttttttataaattaataatattgttaaaggcctgacaatactattttcatcccccaacaaat
aaaaaggagcaatttacATG

    BXB0078


Gene: BXB0078     GI: 21392963     BI number: GeneID:1158853     GOG: COG1280     Description: amino acid efflux protein, (pXO2-63


  t
t  t
 gc
 at
 at
 gc
 ta
 gc
g  a
 ta
 gc
 at
g  a        a
a  g      g  t
t  |      c  c
a  |      g  a
a  |      c  t
a  |      c  t
c  |       at
a  |       ta
a  |       gt
t  |       gc
t  |       tg
g  |      |  t
 cg        gc         g
 cg        gc       t  a
 at        gc       a  t
 tg        at        cg
a  g       ta        at
t  t      c  c       ta
t  |      a  a       cg
 ta       a  |       cg
 gc       c  |       cg
a  c       at        ta
 tg        cg        gc
 gc        ta        cg
                        ttttttgttgtcaaaattaaaaacttaagtttttttataaattaataatattgttaaaggcctgacaatactattttcatcccccaacaaataaaaaggagcaatttacATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[E] COG1280 Putative threonine efflux protein ... can be seen here

                                                                        Genes that have a predicted attenuator with a riboswitch:

Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here

    ..................................................................................................................