Gene putatively regulated by attenuation in B_anthracis_A2012_pl-pXO2

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:86 nt.    Distance to gene:78 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-12.30 kcal/mol
Antiterminator:    Distance from promoter:70 nt. Size=27 nt.     Delta G= -5.00 kcal/mol
Anti-antiterminator:    Distance from promoter:23 nt.    Size=55 nt.     Delta G= -7.80 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttaaag-tataat. It has a score value of 67.6 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttaaagaattgtaagttgttgtataatggaatcaaaccatatgtaagatagtttccccgatatgaataaccagatattttatgtgtcctgtatattggct
gtaacctcaaaaagagcttgtagtgatttctacaagttctttttgcattgattactaatagcaagcattacaatgatatactaatattaagtttttttag
aaaggataggcggggagaaatATG

    BXB0100


Gene: BXB0100     GI: 21392983     BI number: GeneID:1158874     GOG: -------     Description: hypothetical protein, (pXO2-73


  t
t  a
t  t
 tg
 at
 tg
 at
|  c
 gc
 at
 cg
c  |
a  |
a  |
t  |
a  |
a  |
 gt
 ta         a
 at       a  a       at
 ta       a  a      g  t
 at        cg       t  t
 gt        ta        gc
 cg        cg        at
 cg       c  c       ta
|  c       at        gc
c  t       at        ta
c  g       tg        ta
t  t       gt        cg
 ta        ta        gt
 ta        cg        at
 gc        gt        gc
                        tttttgcattgattactaatagcaagcattacaatgatatactaatattaagtttttttagaaaggataggcggggagaaatATG


    ..................................................................................................................