                                                                        Gene putatively regulated by attenuation in B_anthracis_A2012_pl-pXO2

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:31 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-14.30 kcal/mol
Antiterminator: Size=54 nt.     Delta G= -4.37 kcal/mol
Anti-antiterminator:   Size=57 nt.     Delta G= -5.77 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GATGAAGTTAAACAAGCATTGCAGCAAGAAATAAATGAATATGAACAAACAAAAGGTC
AATCTAATCCTGAAAAACTAAGAGCAGTAAATACTACTGAAATTAGTGAGATTCAACA
GGGGAAGGTTGACCGTTTTTTATCTAATAAAACGGAAAAAGATGAAGATGCAGCCGCA
ATAAAACAGCAAGAAGCAAGAAGGATGGCACGTATGGCATACATGCAACGAATGGAGA
GATAAgaggacaccttaataggtgttctttttttattttaaatttcaactaataaggagagataaataATG

    BXB0110 --- BXB0109 Gene: BXB0110     GI: 21392992     BI number: GeneID:1158884     GOG: -------     Description: hypothetical protein, (pXO2-80) Gene: BXB0109     GI: 21392991     BI number: GeneID:1158883     GOG: COG1988     Description: conserved hypothetical protein, (pX02-79             A           C  T           G  A            GC            TA            AT   G        TG A  A       GC A  A      |  A CG       |  A GC       |  C A  A      |  G C  A      |  A A  G      |  A A  A      |  T A  A      |  G A  G      |  G T  G      |  A A  A      |  G A  |      |  A C  |      |  G GT       |  A CG       |  T CG       |  A       aa GC       |  A      t  t |  A      |  g       ta A  C      C  a       cg CG       A  g       cg GT       C  g       at TA       G  a       cg AT        Gc        at G  G       Ta        gt A  G      A  |       gc A  |       Gc        at GC        Gc        gt TA        At        At AT        At        At                         tttattttaaatttcaactaataaggagagataaataATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG1988 Predicted membrane-bound metal-dependent hydrolases ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_anthracis_A2012_pl-pXO2                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:38 nt.     Distance to run of Ts=0 nt.   Size=18 nt.     Delta G= -7.90 kcal/mol Antiterminator: Size=54 nt.     Delta G= -4.37 kcal/mol Anti-antiterminator:   Size=15 nt.     Delta G= -3.50 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case GATGAAGTTAAACAAGCATTGCAGCAAGAAATAAATGAATATGAACAAACAAAAGGTC AATCTAATCCTGAAAAACTAAGAGCAGTAAATACTACTGAAATTAGTGAGATTCAACA GGGGAAGGTTGACCGTTTTTTATCTAATAAAACGGAAAAAGATGAAGATGCAGCCGCA ATAAAACAGCAAGAAGCAAGAAGGATGGCACGTATGGCATACATGCAACGAATGGAGA GATAAgaggacaccttaataggtgttctttttttattttaaatttcaactaataaggagagataaataATG     BXB0110 --- BXB0109 Gene: BXB0110     GI: 21392992     BI number: GeneID:1158884     GOG: -------     Description: hypothetical protein, (pXO2-80) Gene: BXB0109     GI: 21392991     BI number: GeneID:1158883     GOG: COG1988     Description: conserved hypothetical protein, (pX02-79             C           G  A           T  A            AC            CG            AA            TA            AT           |  G           |  G           |  A           |  G           |  A           |  G           |  A           |  T           |  A           |  A           |  g           |  a           |  g           |  g           |  a           |  c           |  a           |  c           C  c           G  t           G  t       aa   A       T  a      t  t C  T       Aa        ta G  A       Tt        cg GC       G  |       cg TA        C        at AT        A        cg TG        C        at GC        G        gt                         ctttttttattttaaatttcaactaataaggagagataaataATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG1988 Predicted membrane-bound metal-dependent hydrolases ... can be seen here     ..................................................................................................................