                                                                        Gene putatively regulated by attenuation in B_anthracis_Ames

This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:83 nt.    Distance to gene:24 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-24.80 kcal/mol
Antiterminator:    Distance from promoter:65 nt. Size=31 nt.     Delta G=-10.71 kcal/mol
Anti-antiterminator:    Distance from promoter:32 nt.    Size=40 nt.     Delta G=-14.90 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: tggaat-tatgat. It has a score value of 64.26 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
The T-box sequence: agggtggcaacgcg is shown in italic-bold style

tggaatggaatgtggaatatctttatgattagtaaacattcccggtgaagagccgttatttctacttgagaggaaggcggtaatgctttcaactagggtggcaacgcgggttaactcccgtccctttatatagggacgggagttttttgtgttttataaaataaaaggaggagtatataATG

    BA0011 Gene: serS     GI: 30260206     BI number: BA0012     GOG: COG0172     Description: seryl-tRNA synthetas ta g  a       aa gt       t  c cg       t  t gc        gc        at gt        gc       t  a at        gc       t  t at        cg        ta gc        gt        cg g  a      c  |       cg a  a      a  |       cg gc       a  |       ta at       c  |       gc g  a      g  |       cg t  g      g  |       cg tg       t  |       cg cg        gc        ta at        gc        cg tg        gc        at cg        at        at                         ttttgtgttttataaaataaaaggaggagtatataATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0172 Seryl-tRNA synthetase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_anthracis_Ames This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:83 nt.    Distance to gene:31 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-24.80 kcal/mol Antiterminator:    Distance from promoter:50 nt. Size=31 nt.     Delta G=-10.71 kcal/mol Anti-antiterminator:    Distance from promoter:11 nt.    Size=58 nt.     Delta G=-14.80 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: tggaat-tatgat. It has a score value of 64.26 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case The T-box sequence: agggtggcaacgcg is shown in italic-bold style tggaatggaatgtggaatatctttatgattagtaaacattcccggtgaagagccgttatttctacttgagaggaaggcggtaatgctttcaactagggtg gcaacgcgggttaactcccgtccctttatatagggacgggagttttttgtgttttataaaataaaaggaggagtatataATG     BA0011 Gene: serS     GI: 30260206     BI number: BA0012     GOG: COG0172     Description: seryl-tRNA synthetas ag g  a tg tg c  a a  a tg cg t  c t  g tg at        gt ta       g  g ta       g  g gt        ac        at c  |       ta       t  a cg        ca       t  t gc        ac        ta at        ag        cg gt       c  |       cg at       t  |       cg a  c      t  |       ta g  a      t  |       gc ta       c  |       cg gc       g  |       cg gt       t  |       cg |  a       ac        ta cg        ag        cg cg        tg        at cg        gg        at                         ttttgtgttttataaaataaaaggaggagtatataATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0172 Seryl-tRNA synthetase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here     ..................................................................................................................