                                                                        Gene putatively regulated by attenuation in B_anthracis_Ames

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:107 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G=-14.70 kcal/mol
Antiterminator: Size=68 nt.     Delta G= -7.99 kcal/mol
Anti-antiterminator:   Size=40 nt.     Delta G=-12.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGTGTAACAAATTTAAAACCTGTAAAATTACGCGGTGAATTATCGCAAGGTATGATTT
TAGCGGGTGAAGAGAATGGTGTATTGTCATTAGCATCTATTGACCAAAATATACCAAA
TGGTACAAAAATCAAGTAAttaagacaagaaaagagatgtttcacgtgtaacatgtgtgaagcgtcttttttctttttacactctc
atttttgcattaagattgtagtattgttatcgttaagttatgaaagagcttatttgcgtagaataaatttgatttcaatataaaaggagttatgtattAT
G

    BA0037 Gene: BA0037     GI: 30260229     BI number: BA0037     GOG: COG0084     Description: deoxyribonuclease, TatD famil            AA           A  T            CG            CG            AT            TA           A  C           T  A           A  A           A  A           A  A           A  A           C  |           C  |            AT            GC            TA            TA           |  G           |  T           |  A           |  A   A       |  t C  T      |  t GC       |  a AT       |  a TA       |  g        a T  T      |  a      a  c AT       |  c       ta CG       |  a       gt TA       |  a      t  g GC       |  g      g  t |  C      |  a       cg |  A      |  a       at |  A      |  a       cg TA       |  a       ta TA       A  g       ta AT        Ta        tg TA        Cg        gc GT        Ta        tg TA        At        at GC        Cg        gc GC        Gt        at TA        At        gt                         ttttctttttacactctcatttttgcattaagattgtagtattgttatcgttaagttatgaaagagcttatttgcgtagaataaatttgatttcaatataaaaggagttatgtattATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG0084 Mg-dependent DNase ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_anthracis_Ames                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:43 nt.    Distance to gene:114 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-11.80 kcal/mol Antiterminator:    Distance from promoter:11 nt. Size=68 nt.     Delta G= -7.99 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: TTGTCA-CAAAAT. It has a score value of 65.6 and is shown in blue Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TTGTCATTAGCATCTATTGACCAAAATATACCAAATGGTACAAAAATCAAGTAAttaaga caagaaaagagatgtttcacgtgtaacatgtgtgaagcgtcttttttctttttacactctcatttttgcattaagattgtagtattgttatcgttaagtt atgaaagagcttatttgcgtagaataaatttgatttcaatataaaaggagttatgtattATG     BA0037 Gene: BA0037     GI: 30260229     BI number: BA0037     GOG: COG0084     Description: deoxyribonuclease, TatD famil ga a  a aa ca ag ga a  g a  a t  t t  g A  t A  t T  | G  | At Ac Ca Tc |  g |  t |  g |  t |  a |  a |  c |  a | | |          a |        a  c |         ta |         gt |        t  g |        g  t |         cg |         at A         cg A        ta A        ta A        tg A        gc C        tg A        at T        gc             ttttttctttttacactctcatttttgcattaagattgtagtattgttatcgttaagttatgaaagagcttatttgcgtagaataaatttgatttcaatataaaaggagttatgtattATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG0084 Mg-dependent DNase ... can be seen here     ..................................................................................................................