                                                                        Gene putatively regulated by attenuation in B_anthracis_Ames

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:116 nt.     Distance to run of Ts=0 nt.   Size=19 nt.     Delta G= -9.40 kcal/mol
Antiterminator: Size=71 nt.     Delta G=-11.50 kcal/mol
Anti-antiterminator:   Size=46 nt.     Delta G= -4.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TATAAGCGAAATAGAGCACAAAGCGGTCAATACTGCTGCCAGTTTCTTAGCGAAACAA
ATGGAACAGTAAaggtgtgtaattttagaagtagcaatctttcctaattatgatatttcttcttgagaaatcaattatttggagatatatg
tatattgaatgaaggtagcgctttgctaccttttttcattgaatatttctagcgttgcacgaacgtattcttacttgtgtaggtgagtaagcttgtcctt
ttctttatgatataatacgaggggtgagaatagaaaaaggagttttcttgtATG

    BA0054 --- BA0055 --- BA0056 Gene: BA0054     GI: 30260246     BI number: BA0054     GOG: -------     Description: stage V sporulation protein B, putative Gene: BA0055     GI: 30260247     BI number: BA0055     GOG: COG1694,COG3956     Description: tetrapyrrole methylase family protein/MazG family protein Gene: BA0056     GI: 30260248     BI number: BA0056     GOG: COG1188     Description: S4 domain protei            aa           g  a            at            gc            ta            ta           |  t           |  t           |  a           |  t           |  t           |  t            cg            tg            ta   c        cg g  a       ta a  a      t  t t  t       ta gc        at at        ta at        at gt       |  g a  c       gt t  c       ta t  t       at ta        ta ta       t  t at       a  t at       a  g        t ta       t  a      c  t gt       c  a      g  t |  g      c  t       cg ta        tg        gc gt        ta        at ta        ta        ta gt        cg        gc gt        tg        gc at        at        at                         tttttcattgaatatttctagcgttgcacgaacgtattcttacttgtgtaggtgagtaagcttgtccttttctttatgatataatacgaggggtgagaatagaaaaaggagttttcttgtATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG1694 Predicted pyrophosphatase ... can be seen here [R] COG3956 Protein containing tetrapyrrole methyltransferase domain and MazG-like (predicted pyrophosphatase) domain ... can be seen here [J] COG1188 Ribosome-associated heat shock protein implicated in the recycling of the 50S subunit (S4 paralog) ... can be seen here     ..................................................................................................................