                                                                        Gene putatively regulated by attenuation in B_anthracis_Ames

This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:113 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G=-22.40 kcal/mol
Antiterminator: Size=34 nt.     Delta G=-10.71 kcal/mol
Anti-antiterminator:   Size=16 nt.     Delta G= -2.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
The T-box sequence: agagtggaaccgcg is shown in italic-bold style

ttttgaaatgccccttcgagtcttctgctgaacagcaaattgctttgcaaaacgtcttagggcgtaaaaagtaagcagaagcggtgtacaccgttatcag
agatgagtttgaggcttttttagcctaaacagagtggaaccgcgcttataaggcgtctctgtcaatatgacagaggcgtctttttttataccgtaaaatt
ggtatgagtataagtcttatccacgtgtataaagatttagggggataagtagggagttagttcactcgaaaaaggagcccataaaggggagggaacgtcg
ATG

    BA0083 --- ispD --- ispF --- gltX --- cysE Gene: cysE     GI: 30260279     BI number: BA0088     GOG: COG1045     Description: serine O-acetyltransferase Gene: cysS     GI: 30260280     BI number: BA0089     GOG: COG0215     Description: cysteinyl-tRNA synthetase Gene: BA0090     GI: 30260281     BI number: BA0090     GOG: COG1939     Description: conserved hypothetical protein Gene: BA0091     GI: 30260282     BI number: BA0091     GOG: COG0566     Description: RNA methyltransferase, TrmH family, group 3 Gene: BA0092     GI: 30260283     BI number: BA0092     GOG: COG3688     Description: conserved hypothetical protei             t           a  a           t  a            tg            cg         t            gc       a  a            cg       a  t            gt        cg           c  |       ta           c  |       gc           a  |       ta           a  |       cg           g  |       ta aa       g  |       cg g  c      t  |       tg gc        gc        gc tg        at        cg gc        gc        gt a  g       at        gc gc        cg        at at        at        at                         tttttataccgtaaaattggtatgagtataagtcttatccacgtgtataaagatttagggggataagtagggagttagttcactcgaaaaaggagcccataaaggggagggaacgtcgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG1045 Serine acetyltransferase ... can be seen here [J] COG0215 Cysteinyl-tRNA synthetase ... can be seen here [S] COG1939 Uncharacterized protein conserved in bacteria ... can be seen here [J] COG0566 rRNA methylases ... can be seen here [R] COG3688 Predicted RNA-binding protein containing a PIN domain ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here     ..................................................................................................................