                                                                        Gene putatively regulated by attenuation in B_anthracis_Ames

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:49 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G= -6.00 kcal/mol
Antiterminator: Size=23 nt.     Delta G= -5.60 kcal/mol
Anti-antiterminator:   Size=45 nt.     Delta G=-14.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AAGCGATTTAGAAAGGAAAGTGCTTTCTTTATATCTAGACGGTCGTTCTTATCAAGAG
ATTTCGGAACAGTTAAATAGACATGTAAAATCTATTGATAACGCTTTACAGAGAGTGA
AGCGGAAATTGGAACGATATATGGAAATGAGAGAGAGTACCACTTCAAATTAAtaacaaga
gctacaggtgtaaaaaatcacctgttttctttttgtagagagtacaaaaggcatgtcattgacattgtcttttattgtatgatacatttttagggacata
atgttacaaggttggtgtaactaATG

    BA0090 --- BA0091 Gene: rpmG-1     GI: 30260285     BI number: BA0094     GOG: -------     Description: ribosomal protein L33 Gene: BA0095     GI: 30260286     BI number: BA0095     GOG: -------     Description: preprotein translocase, SecE subuni aa a  a a  a t  t gc ta gc gc at cg at t  t        g         t c  |      a  a      a  t gt       g  g       cg at        at        ta gc        ta        gc at        gc        ta at        ta       |  t c  t       ta        at at        ta        cg at        ta        gt tg        tg        gc At        cg        at                         tttattgtatgatacatttttagggacataatgttacaaggttggtgtaactaATG     ..................................................................................................................