Gene putatively regulated by attenuation in B_anthracis_Ames

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:110 nt.    Distance to gene:50 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-18.10 kcal/mol
Antiterminator:    Distance from promoter:48 nt. Size=74 nt.     Delta G=-11.27 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgact-tataat. It has a score value of 89.69 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgacttcataaagaagtttttatataatcatttatgttgtgaatttaaatagtgtaccgtagacagtaggtgtcaatagacttaatttcctacctaggt
gttaatatacgaagcggaatttttttctgtgactatatgcctccatgtctacaagttgggcatggaggtttttagtgcactttcggtacatcttctatat
aatctacaggaggtgtaataacATG

   ف


Gene: rplJ     GI: 30260290     BI number: BA0099     GOG: COG0244     Description: ribosomal protein L1


  t
t  t
t  t
 at
 at
 gc
 gt
 cg
 gt
a  g
a  a
g  c
c  |
 at
 ta
 at
 ta
 at
a  |
t  |
t  |
g  |
 tg
 gc
 gc
 at
t  c
c  c
c  a
a  t
t  |        a
c  |      a  g
c  |      c  t
t  |       at
t  |       tg
t  |       cg
a  |       tg
a  |       gc
t  |       ta
t  |       at
 cg        cg
 at        cg
 gc        ta
 at        cg
 ta        cg
            tttttagtgcactttcggtacatcttctatataatctacaggaggtgtaataacATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[J] COG0244 Ribosomal protein L10 ... can be seen here

    ..................................................................................................................