Gene putatively regulated by attenuation in B_anthracis_Ames

This operon is putativelly rgulated by Methionine_S-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:166 nt.    Distance to gene:29 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-18.00 kcal/mol
Antiterminator:    Distance from promoter:138 nt. Size=42 nt.     Delta G=-13.80 kcal/mol
Anti-antiterminator:    Distance from promoter:136 nt.    Size=26 nt.     Delta G= -6.90 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaca-tactat. It has a score value of 74.97 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgacaattctttttgtaagatttactattagtaccatattaaaaactacatacacatactcttatcaagagtggcggagggactggcccgatgatgccc
ggcaaccgagcttatgacgtataagctaaggtgctaattcctgcaaaatgagttttcgttttggaagataagagaggatcctattttgtctattcggcac
ctctcttatttttgagaggtgctttttattttggaacatatatgaagggggaactatagATG

    BA0175 --- BA0174 --- BA0173


Gene: BA0175     GI: 30260362     BI number: BA0175     GOG: COG1464     Description: ABC transporter, substrate-binding protein, putative
Gene: BA0174     GI: 30260361     BI number: BA0174     GOG: -------     Description: ABC transporter, ATP-binding protein
Gene: BA0173     GI: 30260360     BI number: BA0173     GOG: COG2011     Description: ABC transporter, permease protei


            t
          a  t
          t  c
           cg
           tg
           gc
           ta
          t  |
          t  |
          t  |
          a  |
          t  |
          c  |       tt
 at       c  |      a  t
g  c      t  |      t  t
 gc       a  |      t  t
 at        gc        cg
g  a       gc        ta
 at        at        cg
 gt        gc        ta
 at        at        cg
 at        gc        cg
 tg        at        at
 at        at        cg
 gc        ta        gc
 at        at        gt
                        ttttattttggaacatatatgaagggggaactatagATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[P] COG1464 ABC-type metal ion transport system, periplasmic component/surface antigen ... can be seen here
[P] COG2011 ABC-type metal ion transport system, permease component ... can be seen here

                                                                        Genes that have a predicted attenuator with a riboswitch:

Methionine_S-box sequence ... can be seen here

    ..................................................................................................................


                                                                        Gene putatively regulated by attenuation in B_anthracis_Ames

This operon is putativelly rgulated by Methionine_S-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:139 nt.    Distance to gene:47 nt.     Distance to run of Ts=0 nt.   Size=40 nt.     Delta G=-12.70 kcal/mol
Antiterminator:    Distance from promoter:136 nt. Size=26 nt.     Delta G= -6.90 kcal/mol
Anti-antiterminator:    Distance from promoter:100 nt.    Size=51 nt.     Delta G= -7.50 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaca-tactat. It has a score value of 74.97 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgacaattctttttgtaagatttactattagtaccatattaaaaactacatacacatactcttatcaagagtggcggagggactggcccgatgatgccc
ggcaaccgagcttatgacgtataagctaaggtgctaattcctgcaaaatgagttttcgttttggaagataagagaggatcctattttgtctattcggcac
ctctcttatttttgagaggtgctttttattttggaacatatatgaagggggaactatagATG

    BA0175 --- BA0174 --- BA0173


Gene: BA0175     GI: 30260362     BI number: BA0175     GOG: COG1464     Description: ABC transporter, substrate-binding protein, putative
Gene: BA0174     GI: 30260361     BI number: BA0174     GOG: -------     Description: ABC transporter, ATP-binding protein
Gene: BA0173     GI: 30260360     BI number: BA0173     GOG: COG2011     Description: ABC transporter, permease protei


 tt
g  t
a  t                  t
 gc                 a  t
 tg                 t  c
 at                  cg
 at                  tg
 at                  gc
 at                  ta
 cg                 t  |
|  g                t  |
g  a                t  |
 ta                 a  |
 cg                 t  |
|  a       at       c  |
|  t      g  c      c  |
c  a       gc       t  |
t  a       at       a  |
t  g      g  a       gc
a  a       at        gc
a  g       gt        at
 ta        at        gc
 cg        at        at
g  g       tg        gc
 ta        at        at
 gt        gc        at
 gc        at        ta
                        tttttgagaggtgctttttattttggaacatatatgaagggggaactatagATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[P] COG1464 ABC-type metal ion transport system, periplasmic component/surface antigen ... can be seen here
[P] COG2011 ABC-type metal ion transport system, permease component ... can be seen here

                                                                        Genes that have a predicted attenuator with a riboswitch:

Methionine_S-box sequence ... can be seen here

    ..................................................................................................................