                                                                        Gene putatively regulated by attenuation in B_anthracis_Ames

This operon is putativelly rgulated by Methionine_S-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:160 nt.    Distance to gene:49 nt.     Distance to run of Ts=0 nt.   Size=38 nt.     Delta G=-17.00 kcal/mol
Antiterminator:    Distance from promoter:132 nt. Size=31 nt.     Delta G= -8.00 kcal/mol
Anti-antiterminator:    Distance from promoter:117 nt.    Size=18 nt.     Delta G= -3.00 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttatca-taaaat. It has a score value of 64.93 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttatcaaagaaacaaaaaattaataaaatttattcgtttactcattgtatcaagagaggtggagggactggccctttgaaacctcggcagcaggttcatt
tttgaatactgtgccacttcctgcaagctttatagcttgaaagatagaatgagggacttcgtttatatacgggtgcataacttgtacgtaaaaatccctc
tttctcaatacgaaaagagggattttttatttttcatttccctcatcatcatccaaacttaattatttaggaggaaaatcaaATG

    BA0195 Gene: BA0195     GI: 30260381     BI number: BA0195     GOG: -------     Description: oligopeptide ABC transporter, oligopeptide-binding protein, putativ                       t                     a  a                     a  c                      cg             a        ta           c  t      c  |           g  a       ta            ta        ta            gc        ta            gt        cg            gt        ta ga        cg        cg g  c       at        cg gt        ta        cg at       a  c       ta gc       t  g       at tg        at        at at        ta        at at        ta        at gt        ta        at                         tatttttcatttccctcatcatcatccaaacttaattatttaggaggaaaatcaaATG                                                                         Genes that have a predicted attenuator with a riboswitch: Methionine_S-box sequence ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_anthracis_Ames This operon is putativelly rgulated by Methionine_S-box                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:165 nt.    Distance to gene:56 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-12.30 kcal/mol Antiterminator:    Distance from promoter:116 nt. Size=60 nt.     Delta G=-21.80 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: ttatca-taaaat. It has a score value of 64.93 and is shown in blue Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ttatcaaagaaacaaaaaattaataaaatttattcgtttactcattgtatcaagagaggtggagggactggccctttgaaacctcggcagcaggttcatt tttgaatactgtgccacttcctgcaagctttatagcttgaaagatagaatgagggacttcgtttatatacgggtgcataacttgtacgtaaaaatccctc tttctcaatacgaaaagagggattttttatttttcatttccctcatcatcatccaaacttaattatttaggaggaaaatcaaATG     BA0195 Gene: BA0195     GI: 30260381     BI number: BA0195     GOG: -------     Description: oligopeptide ABC transporter, oligopeptide-binding protein, putativ   a c  t g  a ta gc gt gt cg at ta a  c t  g at ta ta ta g  a c  a        t t  |      a  a t  |      a  c c  |       cg at        ta gc       c  | gc        ta gc        ta at        ta gc        cg t  t       ta at        cg at        cg gc        cg at        ta             ttttttatttttcatttccctcatcatcatccaaacttaattatttaggaggaaaatcaaATG                                                                         Genes that have a predicted attenuator with a riboswitch: Methionine_S-box sequence ... can be seen here     ..................................................................................................................