Gene putatively regulated by attenuation in B_anthracis_Ames

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:98 nt.    Distance to gene:111 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-11.40 kcal/mol
Antiterminator:    Distance from promoter:35 nt. Size=77 nt.     Delta G= -5.41 kcal/mol
Anti-antiterminator:    Distance from promoter:24 nt.    Size=36 nt.     Delta G= -4.60 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGCCA-TAGTAT. It has a score value of 68.94 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGCCATGCAATTCCTGAGAAATATGGTAGTATTTCAACGGTTTTCATACGCCGCAAA
GATAGCTATATGACGAATTCAATGCGTAGCTTTTTAAAAACAATCGAAGAGCACCACC
ACATTAATATGCTTTAAaagacattcttacacgaatgtctttttttcttacaaaagtgtaagtcttccgtaagctaattcgatagttg
caggcgatcatatttcctataattaagacataaagcagggcaacaacaattcgaaaaggagcggatacgcATG

    BA0207 --- BA0206


Gene: BA0207     GI: 30260391     BI number: BA0207     GOG: -------     Description: hypothetical protein
Gene: BA0206     GI: 30260390     BI number: BA0206     GOG: -------     Description: hypothetical protei


           AC
          A  A
          A  A
          A  T
          A  C
           TG
           TA
           TA
           TG
           TA
           CG
           GC
          |  A
          |  C
          |  C
          |  A
          |  C
          |  C
          |  A
          |  C
          |  A
          |  T
          |  T
          |  A
          |  A
           AT
           TA
           GT
  A        CG
G  A       GC
C  T      |  T
 AT       |  T
 GC       |  T
 TA       |  A
|  A      T  A       ac
|  T      A  a      t  a
|  G      A  a      t  c
A  C       Cg        cg
 TG        Ta        ta
 AT       |  c       ta
 TA        Ta        at
 CG        At        cg
 GC        At        at
 AT        Gc        gc
T  T      C  |       at
 AT        At        at
 GT        Gt        At
 AT        Ta        At
                        tttcttacaaaagtgtaagtcttccgtaagctaattcgatagttgcaggcgatcatatttcctataattaagacataaagcagggcaacaacaattcgaaaaggagcggatacgcATG


    ..................................................................................................................