                                                                        Gene putatively regulated by attenuation in B_anthracis_Ames

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:164 nt.    Distance to gene:21 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-16.40 kcal/mol
Antiterminator:    Distance from promoter:150 nt. Size=26 nt.     Delta G= -5.60 kcal/mol
Anti-antiterminator:    Distance from promoter:120 nt.    Size=40 nt.     Delta G=-18.50 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: tttagc-tagatt. It has a score value of 65.6 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tttagctgcacgtgccaaatttttagattttatctatttttgtcgtgcgatttttcatgatgtagttgttaacgggatacgtctgtccttttttaacaat
tgcatagtagctatagaacgatagaaatctcttcacccatttttaatacacgtgtgaaaagggagctatttagcttcctttttctatgtcgaaaaccatg
gggaatgtttctttcccatggttttttatattgaaaggagtacggaaaATG

    BA0228 Gene: BA0228     GI: 30260407     BI number: BA0228     GOG: -------     Description: ABC transporter, ATP-binding protei tt a  t ta cg gc at                  tt gt                 g  t gc        aa       t  c gc       g  a       at at       c  a       at at       t  c       gt at        gc        gc at        ta        gc gt        at        gc t  c       tg        ta gt        cg        at ta       t  g       cg gt       t  g       cg cg        ta        at at        ta        at                         ttttatattgaaaggagtacggaaaATG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_anthracis_Ames                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:130 nt.    Distance to gene:65 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G=-10.20 kcal/mol Antiterminator:    Distance from promoter:92 nt. Size=47 nt.     Delta G= -6.43 kcal/mol Anti-antiterminator:    Distance from promoter:52 nt.    Size=44 nt.     Delta G= -5.00 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: tttagc-tagatt. It has a score value of 65.6 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case tttagctgcacgtgccaaatttttagattttatctatttttgtcgtgcgatttttcatgatgtagttgttaacgggatacgtctgtccttttttaacaat tgcatagtagctatagaacgatagaaatctcttcacccatttttaatacacgtgtgaaaagggagctatttagcttcctttttctatgtcgaaaaccatg gggaatgtttctttcccatggttttttatattgaaaggagtacggaaaATG     BA0228 Gene: BA0228     GI: 30260407     BI number: BA0228     GOG: -------     Description: ABC transporter, ATP-binding protei             a ag       t  a t  t      t  t a  a      t  a cg       t  c gc       t  a t  t      a  c t  a      c  g a  t      c  t a  |       cg c  |       at a  |       cg a  |       ta t  |      |  a t  |      |  a ta        ta tg        cg        tt ta        tg       a  t ta        cg        ta c  c       ta        cg cg       a  g       gc ta       a  |       at gt       a  |       gt ta        gc        gc cg        at        gc ta        ta        at                         ttttctatgtcgaaaaccatggggaatgtttctttcccatggttttttatattgaaaggagtacggaaaATG     ..................................................................................................................