                                                                        Gene putatively regulated by attenuation in B_anthracis_Ames

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:76 nt.    Distance to gene:37 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-13.10 kcal/mol
Antiterminator:    Distance from promoter:46 nt. Size=35 nt.     Delta G= -6.50 kcal/mol
Anti-antiterminator:    Distance from promoter:7 nt.    Size=53 nt.     Delta G= -8.10 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgctt-tataat. It has a score value of 68.94 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgctttttgcacatacaaaacttataattgataaagtgtaataacgtttagaagtattttcgtgaagaatatacgcccgtttatatacgtgagcattca
ggaaaagggcttttccgcaaattcggaaaacgcctttttttaaatgataagtataggatagaaaaggagaagtaacaTTG

    BA0247 Gene: BA0247     GI: 30260423     BI number: BA0247     GOG: COG0513     Description: ATP-dependent RNA helicase, DEAD/DEAH box famil   g t  a g  a cg ta ta t  t       ta ta       a  c at        tg ta        at gc        tg a  g       ta a  c       tg g  c       gc        aa a  |      |  a      a  t t  |      |  t      c  t t  |      |  t       gc t  |      |  c       cg gc       |  a       cg cg       |  g       ta at       |  g       ta at       |  a       ta t  t      |  a       ta a  a      |  a      |  c at       |  a       cg ta        cg        gc gt        cg        gc ta        cg        gt gc        gc        at                         tttttaaatgataagtataggatagaaaaggagaagtaacaTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [LKJ] COG0513 Superfamily II DNA and RNA helicases ... can be seen here     ..................................................................................................................