                                                                        Gene putatively regulated by attenuation in B_anthracis_Ames

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:94 nt.    Distance to gene:31 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G= -9.30 kcal/mol
Antiterminator:    Distance from promoter:33 nt. Size=67 nt.     Delta G=-10.51 kcal/mol
Anti-antiterminator:    Distance from promoter:9 nt.    Size=44 nt.     Delta G= -8.60 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgtca-tgaaat. It has a score value of 65.6 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgtcaaataaaacaaaaccattgaaatgaatatttacttttgatgggctacacgaatcgggttcttactgcctgtttgagcgagataaaagaaggatag
gaagatgagaggaggtaggcatgggaatactgaatagaggttcggtatgttctttttctgtgcataaagaaatttcctgtgctaataaATG

    BA0323 Gene: BA0323     GI: 30260493     BI number: BA0323     GOG: COG1597     Description: conserved hypothetical protein TIGR0014            aa           g  g           a  g           a  a           a  t           a  a           t  g           a  g           g  a           a  a           g  g           c  a   g       g  t c  g      a  g tg       g  a at        tg at        ta gc        tg c  t      g  g a  t       ta        ga c  a       cg       a  g a  c       cg        tg t  t       gt        at cg        ta        at gc        cg        gc gc       |  g       tg gt       |  c       cg tg       |  a       at at        at        ta gt        tg        at t  t       tg       |  g t  |       cg        at tg        ta        gt ta        ta        gc cg        gt        gt                         ttttctgtgcataaagaaatttcctgtgctaataaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [IR] COG1597 Sphingosine kinase and enzymes related to eukaryotic diacylglycerol kinase ... can be seen here     ..................................................................................................................