                                                                        Gene putatively regulated by attenuation in B_anthracis_Ames

This operon is putativelly rgulated by Methionine_S-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:168 nt.    Distance to gene:32 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-15.70 kcal/mol
Antiterminator:    Distance from promoter:136 nt. Size=49 nt.     Delta G= -5.10 kcal/mol
Anti-antiterminator:    Distance from promoter:104 nt.    Size=57 nt.     Delta G=-11.00 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgcac-tacaat. It has a score value of 68.27 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgcacgaaaaaaggaaatgaattacaatttaactatctaaaaattaaaaattttaaaactgaataattctttatcaagagaggcagagggaccggccct
ttgaagcccagcaacctcagtttatacaaactgaataggtgctaattcctgcaaaatgcattgcattttgaaagataaaacgtaactattgtgtacaaaa
ctcatctttcttgatcatgaaaggtgagtttttttatatttcaaaacatatattggaggtatttaaaATG

    BA0361 Gene: BA0361     GI: 30260529     BI number: BA0361     GOG: COG1878     Description: conserved hypothetical protei   t a  t cg gc ta        at at       t  t at        cg at        at at       |  g cg        at g  a       ta t  a       gc c  a      |  a cg       |  a       at ta       c  a      g  c |  t      a  a      t  a |  a      a  c      t  t t  a      a  t       cg a  a      a  c       ta a  a       ta        ta t  c       at        ta cg        gc        cg gt        at        tg ta        at        at g  a       at        cg gc        gc        ta at       t  t       cg ta       t  t       at at        tg        at at        ta        at                         ttttatatttcaaaacatatattggaggtatttaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG1878 Predicted metal-dependent hydrolase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Methionine_S-box sequence ... can be seen here     ..................................................................................................................