                                                                        Gene putatively regulated by attenuation in B_anthracis_Ames

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:179 nt.    Distance to gene:46 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-14.00 kcal/mol
Antiterminator:    Distance from promoter:149 nt. Size=44 nt.     Delta G= -8.60 kcal/mol
Anti-antiterminator:    Distance from promoter:114 nt.    Size=43 nt.     Delta G=-13.20 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgtaa-tgtaat. It has a score value of 70.28 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgtaatctttgatagagaataatgtaattctcatagaactcccatatcgttcaactcgttcagcgagaaaggcaaactgatggaaacattaggacgcaa
aactacaggagctaaggccgaaaggctacgctagccagttaccggacggatagggttggtcttgaccaatgctttttcattggtctttttttatttgcaa
acaaatgagaaaccttatcagttgttgataaggtttctattttaatagttttcctttatattaagttaattaagaaaggtgatgttgATG

    BA0379 Gene: BA0379     GI: 30260546     BI number: BA0379     GOG: -------     Description: methyl-accepting chemotaxis protei tt c  g       aa ta       c  a gc        gc gc        ta ta        ta ta        ta gt        at g  g       tg gc        ta         t at        tg       t  g |  t       ta        gt |  t       ta        at |  t       ta        cg |  t      |  c       ta |  c      |  c       at ta       t  t       ta at       c  t       ta gt        ta        cg g  g       gt        cg cg        gc        at at        ta        at gc        tg        at gt        at        gc                         tattttaatagttttcctttatattaagttaattaagaaaggtgatgttgATG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_anthracis_Ames                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:134 nt.    Distance to gene:93 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G= -9.20 kcal/mol Antiterminator:    Distance from promoter:122 nt. Size=22 nt.     Delta G= -8.10 kcal/mol Anti-antiterminator:    Distance from promoter:100 nt.    Size=31 nt.     Delta G= -9.40 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: ttgtaa-tgtaat. It has a score value of 70.28 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ttgtaatctttgatagagaataatgtaattctcatagaactcccatatcgttcaactcgttcagcgagaaaggcaaactgatggaaacattaggacgcaa aactacaggagctaaggccgaaaggctacgctagccagttaccggacggatagggttggtcttgaccaatgctttttcattggtctttttttatttgcaa acaaatgagaaaccttatcagttgttgataaggtttctattttaatagttttcctttatattaagttaattaagaaaggtgatgttgATG     BA0379 Gene: BA0379     GI: 30260546     BI number: BA0379     GOG: -------     Description: methyl-accepting chemotaxis protei ga g  c cg cg a  a t  t       tt        tt t  a      c  g      t  t g  g       ta       c  t a  |       gc        gc cg        gc        ta cg        ta        at gt        ta        at at        gt        cg tg       g  g       cg cg        gc        at gt        at        gc                         tttttttatttgcaaacaaatgagaaaccttatcagttgttgataaggtttctattttaatagttttcctttatattaagttaattaagaaaggtgatgttgATG     ..................................................................................................................