Gene putatively regulated by attenuation in B_anthracis_Ames

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:164 nt.    Distance to gene:22 nt.     Distance to run of Ts=0 nt.   Size=38 nt.     Delta G= -9.80 kcal/mol
Antiterminator:    Distance from promoter:107 nt. Size=78 nt.     Delta G= -4.00 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGTCT-TAAATA. It has a score value of 60.91 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGTCTGGAAACCGTTTCTTTAGTAAATACGAAATAGCAAATACAAGGATAATCGTGA
TTCCGCCAATGATGTAAAATATACCAAACCCATCTAACCAGTCCATACTATTCCCTCC
TTCCATggattcccttatacttattatatgtttaacttttctgaaaataaataatgaattttattcaaaaacatatttttattactaggtattaat
agtaatatatagtaataggttttatatgattaggaggattactttATG

    BA0394


Gene: BA0394     GI: 30260561     BI number: BA0394     GOG: COG1524     Description: type I phosphodiesterase/nucleotide pyrophosphatase family protei


  t
t  t
 ta
 at
 at
 gc
 ta
|  a
a  a
a  a
t  a
a  c
a  a
 at
 ta
 at
 at
 at
 at
 gt
 ta
c  t
t  t
t  a       ta
t  c      a  g
t  |       at
c  |       ta
a  |       ta
 at        at
 ta        ta
t  g       gt
t  g      g  a
 gt        at
 ta        ta
 at        cg
t  |       at
 at        ta
 ta        ta
 ta        at
 at        ta
 ta        tg
 tg        tg
            ttttatatgattaggaggattactttATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[R] COG1524 Uncharacterized proteins of the AP superfamily ... can be seen here

    ..................................................................................................................