Gene putatively regulated by attenuation in B_anthracis_Ames

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:202 nt.    Distance to gene:26 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G= -9.00 kcal/mol
Antiterminator:    Distance from promoter:145 nt. Size=68 nt.     Delta G= -5.25 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: atgata-tattat. It has a score value of 68.27 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

atgataatgatagcatgttaatatattatatattgaatacgtttagggggatgtattATGCATTTATTTGAAGTAGATAGAG
AGTGTACTTATAAAAGTGTAGATTACAAAGTTATTTCTGTATTAGACAACGATCTATT
ATTAGTTGTACCTAAAGAAGATTTAGCAAATGAAAAATTCCCGTTACAAACTTACGTT
ATTCCAGAACAAATTGAATAAacttattatccaaaagggcttttacatcaaagctctttttatttggttaaaaataatgaggtga
tacaTTG

    BA0481 --- BA0482


Gene: BA0481     GI: 30260643     BI number: BA0481     GOG: NOG08887     Description: phage minor structural protein
Gene: BA0482     GI: 30260644     BI number: BA0482     GOG: -------     Description: conserved domain protei


  C
A  A
A  A
G  A
A  T
C  T
 CG
 TA
 TA
 AT
 TA
 TA
|  a
G  c
C  t
A  t
T  a
T  t
C  t
A  a
A  t
A  c
C  c       ca
A  a      a  t
T  a      t  c
T  a       ta
G  a       ta
 Cg        ta
 Cg        cg
 Cg        gc
T  c       gt
T  t       gc
 At        at
 At        at
 At        at
            ttatttggttaaaaataatgaggtgatacaTTG
    ..................................................................................................................