Gene putatively regulated by attenuation in B_anthracis_Ames
Characteristics of the secondary structures
Terminator: Distance from promoter:129 nt. Distance to gene:82 nt. Distance to run of Ts=0 nt. Size=21 nt. Delta G= -7.00 kcal/mol
Antiterminator: Distance from promoter:91 nt. Size=44 nt. Delta G= -8.20 kcal/mol
Anti-antiterminator: Distance from promoter:56 nt. Size=52 nt. Delta G=-13.00 kcal/mol
Nomenclature/Definitions
The most likely promoter is: TTAAAG-TATATT. It has a score value of 68.27 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator
structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
TTAAAGATGAGAATTTCAGATATTATATTTTAAAGCAAAAAGCAGATGTATTCCATGC
GATGAAGAGCTTCTTTAGAGAAGAATCAGGAGAGAAAATGGCATAGcccccttaaaaaggggttat
ttttttgttaactttttatttttttagttgacaatgataatgaaaatcattatcatttattcgagatatgattacatttagatttatatattttggagga
gatgtaaagttgaaaaaaataaaagaaaacatataaatgcgATG
BA0552
Gene: BA0552 GI: 30260710 BI number: BA0552 GOG: ------- Description: internalin, putativ
aa
t a
t a
c a
cg tt
cg a t
cg t t
cg t t
Gt t t
At t t
Ta ta
At cg
C t at
G t at
G | tg
T | ta
At gc a
At ta a a
At ta a t
At t t gc
G g t | ta
At t | at
Gt tg at
A a ta ta
G a at at
Gc ta gc
At ta ta
tttattcgagatatgattacatttagatttatatattttggaggagatgtaaagttgaaaaaaataaaagaaaacatataaatgcgATG
..................................................................................................................