Gene putatively regulated by attenuation in B_anthracis_Ames

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:125 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-21.10 kcal/mol
Antiterminator: Size=62 nt.     Delta G=-19.00 kcal/mol
Anti-antiterminator:   Size=48 nt.     Delta G= -8.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TATGTATATAAATATGATAATGGTGATGGAACATACGAATTATCAGTAAAATAAgtactt
ttccaatgtatgtttaactttactttttgtggaaaatagtatattatatagatatataatatatcggttattttctaggaggagcctgtcacaataggct
tctcctgttcttttttaaaggcctgtactgcaggcttttctttaaaggggaaataactgaaaattaagaacaataatctttgaaagaggtggggcataca
cataacaaaaaagggattgtttaagagagggggataagaaATG

    BA0556 --- BA0557


Gene: BA0556     GI: 30260714     BI number: BA0556     GOG: NOG47428     Description: conserved hypothetical protein
Gene: BA0557     GI: 30260715     BI number: BA0557     GOG: COG2268     Description: SPFH domain/band 7 family protei


           ga
          a  t
           ta
           at
           ta
           at
           ta
           ta
 ac        at
a  t       ta
t  t       at
t  t       ta
 ta        gt
 gc       |  c
t  t      |  g
a  t      |  g
t  t      |  t
g  t       at        ac
t  t       ta       c  a
a  g       at        ta
 at        at        gt
 cg        at        ta
 cg        at        cg
 ta        gc        cg
 ta        gt        gc
 ta        ta        at
|  a      g  g       gt
|  t       tg        gc
 ta        ta        at
 cg        tg        gc
 at        tg        gc
 ta        ta        at
 gt        cg        tg
                        ttcttttttaaaggcctgtactgcaggcttttctttaaaggggaaataactgaaaattaagaacaataatctttgaaagaggtggggcatacacataacaaaaaagggattgtttaagagagggggataagaaATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[S] COG2268 Uncharacterized protein conserved in bacteria ... can be seen here

    ..................................................................................................................