                                                                        Gene putatively regulated by attenuation in B_anthracis_Ames

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:96 nt.     Distance to run of Ts=1 nt.   Size=31 nt.     Delta G=-16.80 kcal/mol
Antiterminator: Size=43 nt.     Delta G= -7.39 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCGTGTTGATAAATCCAGAACAAGAGCTACTGGAGGAAAAGGTATCGGGCTAGCTGTT
GCTAAAGAAATTGTAGAATTGCATAACGGTTCCATTCTAGTAACAAGCAAATTAGACG
TAGGAACAAACTTTATAATCGAGCTACCTTTTGAATAAtatgtgtgtgaaaacaccagtagtagtaaaaact
actggtgttattttgttcataaaattagcttatataagctaagcttttgaaattattcttatttcaatataaaataaagatacatttgtcaaagatttgg
agggtgatataaTTG

    BA0583 Gene: BA0583     GI: 30260740     BI number: BA0583     GOG: -------     Description: acetyltransferase, GNAT famil aa g  a ta gc ta gc t  | gc ta a  g t  t A  a        a A  |      t  a T  |      g  a A  |      a  a A  |       ta G  |       gc T  |       at T  |       ta T  |       gc T  |       at C  |       cg Cg        cg At        at Ta        cg Cg        at Gt        at             attttgttcataaaattagcttatataagctaagcttttgaaattattcttatttcaatataaaataaagatacatttgtcaaagatttggagggtgatataaTTG     ..................................................................................................................