Gene putatively regulated by attenuation in B_anthracis_Ames

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:103 nt.    Distance to gene:23 nt.     Distance to run of Ts=1 nt.   Size=29 nt.     Delta G=-14.20 kcal/mol
Antiterminator:    Distance from promoter:81 nt. Size=27 nt.     Delta G= -4.90 kcal/mol
Anti-antiterminator:    Distance from promoter:47 nt.    Size=45 nt.     Delta G= -6.00 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAAT-CATATT. It has a score value of 72.29 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAATATAGAACAATCGATTCACATATTCGTAATATCCGCGATAAATTACGGAAAAA
AGGATTTCCAGTTGAAAATTACTTAGAAACTGTTTATAAGGTCGGATATAAATGGAAA
AGTGAATAAtcacttcggtcagtggaaactagtataccactgaccctttattatgaataaggtatggtgagaaaATG

    BA0584


Gene: BA0584     GI: 30260741     BI number: BA0584     GOG: -------     Description: sensor histidine kinas


 TC
G  G
G  G
A  A
 AT
 TA
 AT
 TA
 TA
 TA                   a
 GT        TA       t  g
 TG       A  A      c  t
 CG        At       a  a
A  A       Gc       a  t
A  A       Ta       a  a
A  |       Gc        gc
G  |       At        gc
A  |       At        ta
 TA       |  c       gc
 TA       A  g       at
 CG       A  g       cg
 AT        Gt        ta
 TG        Gc        gc
 TA        Ta        gc
                        ctttattatgaataaggtatggtgagaaaATG


    ..................................................................................................................