                                                                        Gene putatively regulated by attenuation in B_anthracis_Ames

This operon is putativelly rgulated by Thiamine_Thi-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:96 nt.    Distance to gene:31 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-13.50 kcal/mol
Antiterminator:    Distance from promoter:61 nt. Size=40 nt.     Delta G= -7.90 kcal/mol
Anti-antiterminator:    Distance from promoter:21 nt.    Size=43 nt.     Delta G= -7.12 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaaa-tgtgct. It has a score value of 67.6 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgaaaccactaggggtgcttgttgtgctgagagaggaataatccttaacccttataacacctgatctaggtaatactagcgaagggaagtggaacaacg
aataaattataattttatttgctgtaaccacttcttatataaagaagtggttttttatttatatacacataccggaaggggatagagaaATG

    BA0725 --- BA0726 --- BA0727 --- BA0728 --- tenI --- goxB --- BA0731 --- thiG --- BA0733 --- thiD Gene: BA0725     GI: 30260873     BI number: BA0725     GOG: COG0819     Description: transcriptional activator TenA, putative Gene: BA0726     GI: 30260874     BI number: BA0726     GOG: -------     Description: ABC transporter, ATP-binding protein Gene: BA0727     GI: 30260875     BI number: BA0727     GOG: -------     Description: ABC transporter, permease protein, putative Gene: BA0728     GI: 30260876     BI number: BA0728     GOG: -------     Description: ABC transporter, substrate-binding protein, putative Gene: tenI     GI: 30260877     BI number: BA0729     GOG: -------     Description: regulatory protein TenI Gene: goxB     GI: 30260878     BI number: BA0730     GOG: COG0665     Description: glycine oxidase Gene: BA0731     GI: 30260879     BI number: BA0731     GOG: -------     Description: conserved hypothetical protein Gene: thiG     GI: 30260880     BI number: BA0732     GOG: COG2022     Description: thiazole biosynthesis protein ThiG Gene: BA0733     GI: 30260881     BI number: BA0733     GOG: COG0476     Description: hesA/moeB/thiF family protein Gene: thiD-1     GI: 30260882     BI number: BA0734     GOG: COG0351,COG1992     Description: phosphomethylpyrimidine kinas aa t  t g  a        t gc       a  a at       t  a ta       t  t cg        at t  c       at a  g       at g  a       ta         a ta        at       t  t cg        at       a  a cg        gt        ta a  g       cg        ta c  a      a  c       cg a  a       at        ta a  g       cg        ta t  t       at        cg a  |      |  a       at t  |      a  a       cg t  |       gc        cg cg        gc        at cg        ta        at                         ttttatttatatacacataccggaaggggatagagaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG0819 Putative transcription activator ... can be seen here [E] COG0665 Glycine/D-amino acid oxidases (deaminating) ... can be seen here [H] COG2022 Uncharacterized enzyme of thiazole biosynthesis ... can be seen here [H] COG0476 Dinucleotide-utilizing enzymes involved in molybdopterin and thiamine biosynthesis family 2 ... can be seen here [H] COG0351 Hydroxymethylpyrimidine/phosphomethylpyrimidine kinase ... can be seen here [S] COG1992 Uncharacterized conserved protein ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Thiamine_Thi-box sequence ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_anthracis_Ames This operon is putativelly rgulated by Thiamine_Thi-box                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:203 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G=-18.50 kcal/mol Antiterminator: Size=46 nt.     Delta G=-12.20 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case tttattacctgatctagattatgctagcgtagggaagcaattcggacactaataatgagtccccgtttctttgcgtatagaaacggggcttttttatttg aaaatttcatattgaaaccactaggggtgcttgttgtgctgagagaggaataatccttaacccttataacacctgatctaggtaatactagcgaagggaa gtggaacaacgaataaattataattttatttgctgtaaccacttcttatataaagaagtggttttttatttatatacacataccggaaggggatagagaa ATG     BA0725 --- BA0726 --- BA0727 --- BA0728 --- tenI --- goxB --- BA0731 --- thiG --- BA0733 --- thiD Gene: BA0725     GI: 30260873     BI number: BA0725     GOG: COG0819     Description: transcriptional activator TenA, putative Gene: BA0726     GI: 30260874     BI number: BA0726     GOG: -------     Description: ABC transporter, ATP-binding protein Gene: BA0727     GI: 30260875     BI number: BA0727     GOG: -------     Description: ABC transporter, permease protein, putative Gene: BA0728     GI: 30260876     BI number: BA0728     GOG: -------     Description: ABC transporter, substrate-binding protein, putative Gene: tenI     GI: 30260877     BI number: BA0729     GOG: -------     Description: regulatory protein TenI Gene: goxB     GI: 30260878     BI number: BA0730     GOG: COG0665     Description: glycine oxidase Gene: BA0731     GI: 30260879     BI number: BA0731     GOG: -------     Description: conserved hypothetical protein Gene: thiG     GI: 30260880     BI number: BA0732     GOG: COG2022     Description: thiazole biosynthesis protein ThiG Gene: BA0733     GI: 30260881     BI number: BA0733     GOG: COG0476     Description: hesA/moeB/thiF family protein Gene: thiD-1     GI: 30260882     BI number: BA0734     GOG: COG0351,COG1992     Description: phosphomethylpyrimidine kinas   t a  a a  a t  t c  g a  a cg at        cg gc       g  t gc       t  a c  c      t  t t  c       ta t  |       cg a  |       ta a  |       ta cg        ta gt        gc at        cg at        cg gc        cg gt        cg gt       t  | at        gc tg        at gc        gt             ttttatttgaaaatttcatattgaaaccactaggggtgcttgttgtgctgagagaggaataatccttaacccttataacacctgatctaggtaatactagcgaagggaagtggaacaacgaataaattataattttatttgctgtaaccacttcttatataaagaagtggttttttatttatatacacataccggaaggggatagagaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG0819 Putative transcription activator ... can be seen here [E] COG0665 Glycine/D-amino acid oxidases (deaminating) ... can be seen here [H] COG2022 Uncharacterized enzyme of thiazole biosynthesis ... can be seen here [H] COG0476 Dinucleotide-utilizing enzymes involved in molybdopterin and thiamine biosynthesis family 2 ... can be seen here [H] COG0351 Hydroxymethylpyrimidine/phosphomethylpyrimidine kinase ... can be seen here [S] COG1992 Uncharacterized conserved protein ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Thiamine_Thi-box sequence ... can be seen here     ..................................................................................................................