Gene putatively regulated by attenuation in B_anthracis_Ames

This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:22 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-18.70 kcal/mol
Antiterminator: Size=38 nt.     Delta G= -6.70 kcal/mol
Anti-antiterminator:   Size=47 nt.     Delta G=-15.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

atgaaatcgtttaagtaagaagagtacgtatattggagacgttacagagagccggggataggtgggagcccggtgcggtgctatatacggaatgggctta
cgagaggtatgctgaacaattattttcagtaggcaacccgggttccgccgttacaaggataaggtatatattttgtacctgaataaagcgggatgctttt
gcgtccaacatgaggtggtaccacggtaaatttatcgtcctctacatattttcgatatgtagaggacttttttatttttcaggatgaggtgaaaggcatg
ATG

    trpE --- pabA --- 2 --- trpD --- BA1251 --- trpF --- trpB


Gene: trpE     GI: 30261343     BI number: BA1248     GOG: COG0147     Description: anthranilate synthase component I
Gene: pabA-2     GI: 30261344     BI number: BA1249     GOG: -------     Description: para-aminobenzoate synthase glutamine amidotransferase, component II
Gene: trpD     GI: 30261345     BI number: BA1250     GOG: COG0547     Description: anthranilate phosphoribosyltransferase
Gene: BA1251     GI: 30261346     BI number: BA1251     GOG: COG0134     Description: indole-3-glycerol phosphate synthase
Gene: trpF     GI: 30261347     BI number: BA1252     GOG: COG0135     Description: N-(5'phosphoribosyl)anthranilate isomerase
Gene: trpB     GI: 30261348     BI number: BA1253     GOG: COG0133,COG1350     Description: tryptophan synthase, beta subunit
Gene: trpA     GI: 30261349     BI number: BA1254     GOG: COG0159     Description: tryptophan synthase, alpha subuni


 tt
t  t
 cg
 gc        at
 tg       a  t
 at        at
 gc        ta
 gc        gt
g  a       gc         t
c  a       cg       t  c
g  c       at        tg
a  a      c  |       ta
a  t      c  |       at
a  g      a  |       ta
t  a      t  |       at
a  g       gc        cg
a  g       gc        at
g  t      t  t       ta
t  |       gc        cg
 cg        gt        ta
 cg       a  a       cg
 at        gc        cg
 ta        ta        ta
 gc        at        gc
                        ttttttatttttcaggatgaggtgaaaggcatgATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[EH] COG0147 Anthranilate/para-aminobenzoate synthases component I ... can be seen here
[E] COG0547 Anthranilate phosphoribosyltransferase ... can be seen here
[E] COG0134 Indole-3-glycerol phosphate synthase ... can be seen here
[E] COG0135 Phosphoribosylanthranilate isomerase ... can be seen here
[E] COG0133 Tryptophan synthase beta chain ... can be seen here
[R] COG1350 Predicted alternative tryptophan synthase beta-subunit (paralog of TrpB) ... can be seen here
[E] COG0159 Tryptophan synthase alpha chain ... can be seen here

                                                                        Genes that have a predicted attenuator with a riboswitch:

Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here

    ..................................................................................................................


                                                                        Gene putatively regulated by attenuation in B_anthracis_Ames

This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:29 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-18.70 kcal/mol
Antiterminator: Size=38 nt.     Delta G= -6.70 kcal/mol
Anti-antiterminator:   Size=47 nt.     Delta G=-15.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

atgaaatcgtttaagtaagaagagtacgtatattggagacgttacagagagccggggataggtgggagcccggtgcggtgctatatacggaatgggctta
cgagaggtatgctgaacaattattttcagtaggcaacccgggttccgccgttacaaggataaggtatatattttgtacctgaataaagcgggatgctttt
gcgtccaacatgaggtggtaccacggtaaatttatcgtcctctacatattttcgatatgtagaggacttttttatttttcaggatgaggtgaaaggcatg
ATG

    trpE --- pabA --- 2 --- trpD --- BA1251 --- trpF --- trpB


Gene: trpE     GI: 30261343     BI number: BA1248     GOG: COG0147     Description: anthranilate synthase component I
Gene: pabA-2     GI: 30261344     BI number: BA1249     GOG: -------     Description: para-aminobenzoate synthase glutamine amidotransferase, component II
Gene: trpD     GI: 30261345     BI number: BA1250     GOG: COG0547     Description: anthranilate phosphoribosyltransferase
Gene: BA1251     GI: 30261346     BI number: BA1251     GOG: COG0134     Description: indole-3-glycerol phosphate synthase
Gene: trpF     GI: 30261347     BI number: BA1252     GOG: COG0135     Description: N-(5'phosphoribosyl)anthranilate isomerase
Gene: trpB     GI: 30261348     BI number: BA1253     GOG: COG0133,COG1350     Description: tryptophan synthase, beta subunit
Gene: trpA     GI: 30261349     BI number: BA1254     GOG: COG0159     Description: tryptophan synthase, alpha subuni


 tt
t  t
 cg
 gc        gg
 tg       c  t
 at        aa
 gc        ca
 gc        ca
g  a       at         t
c  a       tt       t  c
g  c       gt        tg
a  a      g  |       ta
a  t      t  |       at
a  g      g  |       ta
t  a      g  |       at
a  g       aa        cg
a  g       gt        at
g  t      t  c       ta
t  |       ag        cg
 cg        ct        ta
 cg       a  c       cg
 at        ac        cg
 ta        ct        ta
 gc        cc        gc
                        ttttttatttttcaggatgaggtgaaaggcatgATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[EH] COG0147 Anthranilate/para-aminobenzoate synthases component I ... can be seen here
[E] COG0547 Anthranilate phosphoribosyltransferase ... can be seen here
[E] COG0134 Indole-3-glycerol phosphate synthase ... can be seen here
[E] COG0135 Phosphoribosylanthranilate isomerase ... can be seen here
[E] COG0133 Tryptophan synthase beta chain ... can be seen here
[R] COG1350 Predicted alternative tryptophan synthase beta-subunit (paralog of TrpB) ... can be seen here
[E] COG0159 Tryptophan synthase alpha chain ... can be seen here

                                                                        Genes that have a predicted attenuator with a riboswitch:

Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here

    ..................................................................................................................