                                                                        Gene putatively regulated by attenuation in B_anthracis_Ames

This operon is putativelly rgulated by Methionine_S-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:166 nt.    Distance to gene:43 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-15.90 kcal/mol
Antiterminator:    Distance from promoter:136 nt. Size=45 nt.     Delta G=-18.00 kcal/mol
Anti-antiterminator:    Distance from promoter:102 nt.    Size=47 nt.     Delta G=-10.12 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgact-taaagt. It has a score value of 85.01 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgacttttgttttgtaagcgagtaaagttagggaagaaattattattaaaaaataaatatgaaaccttcttataaagagaggcggagggactggcccta
cgatgcctcggcagcggactcgattttagagtgctgtgccaaatccagcaagcatgtgcttgaaagatgagaagagcgtttcttatagatgtataagacc
tcttctcgttggaagaggtcttttgttattcattagaaaaaaggttgaaactagggagagatggtactTTG

    BA1452 Gene: BA1452     GI: 30261531     BI number: BA1452     GOG: COG1757     Description: Na+/H+ antiporter family protei tg a  t       ga cg       a  t gc        tg at        at at        ta cg       t  t g  a      c  a a  a       ta c  a       tg cg        ta ta        gc        gt at       c  |      c  t a  g       gc        tg a  a       at        cg c  g       gc        ta c  a       at        ta g  a       at        cg t  g       gc        ta g  |       at        cg ta        gc        cg cg        tg        at gc        at        gc tg        gt        at                         tttgttattcattagaaaaaaggttgaaactagggagagatggtactTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG1757 Na+/H+ antiporter ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Methionine_S-box sequence ... can be seen here     ..................................................................................................................