                                                                        Gene putatively regulated by attenuation in B_anthracis_Ames

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:71 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G=-17.40 kcal/mol
Antiterminator: Size=42 nt.     Delta G= -3.70 kcal/mol
Anti-antiterminator:   Size=41 nt.     Delta G=-18.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATTTCGAAATACGTATTAGATGTAGCGCAATCGTTTAATAAATATTACGGGAATGTGC
GTATATTAGAAGAGAGTGAAGAGAAAGACAGTAGACTGGCATTAGTGTATGCTGTGAC
GGTTGTATTAAAAGAGGGGTTACGTTTACTTGGGGTGGAGGCACCTGAGGAGATGTAA
catagtaataaactgacaaactgggtttagtatataaacctggtttgttttttatttggatatataattaattttcaaaatcaattaaaatctttttaga
gaggatgatttatattgattcgaaatATG

   ف --- BA2176 Gene: BA2176     GI: 30262192     BI number: BA2176     GOG: COG3815     Description: conserved hypothetical protein Gene: BA2177     GI: 30262193     BI number: BA2177     GOG: -------     Description: hypothetical protei             t           a  a           a  a            ta AG        gc G  G       at GC        tg TA       a  |        a GC       c  |      t  t GC       A  |      g  a GT       A  |       at G  G       Ta        ta TA        Gc        ta TG        Ta        ta CG       A  a       gc A  |      G  a       gc TA       A  |      g  t TG       G  |      t  g TA        Gc        cg GT        At        at CG       G  |       at AT        Tg        at TA        Cg        cg TA        Cg        at Gc        At        gt                         ttttatttggatatataattaattttcaaaatcaattaaaatctttttagagaggatgatttatattgattcgaaatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG3815 Predicted membrane protein ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_anthracis_Ames                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:78 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-10.00 kcal/mol Antiterminator: Size=42 nt.     Delta G= -3.70 kcal/mol Anti-antiterminator:   Size=41 nt.     Delta G=-18.50 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ATTTCGAAATACGTATTAGATGTAGCGCAATCGTTTAATAAATATTACGGGAATGTGC GTATATTAGAAGAGAGTGAAGAGAAAGACAGTAGACTGGCATTAGTGTATGCTGTGAC GGTTGTATTAAAAGAGGGGTTACGTTTACTTGGGGTGGAGGCACCTGAGGAGATGTAA catagtaataaactgacaaactgggtttagtatataaacctggtttgttttttatttggatatataattaattttcaaaatcaattaaaatctttttaga gaggatgatttatattgattcgaaatATG    ف --- BA2176 Gene: BA2176     GI: 30262192     BI number: BA2176     GOG: COG3815     Description: conserved hypothetical protein Gene: BA2177     GI: 30262193     BI number: BA2177     GOG: -------     Description: hypothetical protei             a           a  t           t  a            ga AG        aa G  G       tc GC        at TA       c  | GC       A  | GC       A  | GT       T  | G  G       Gg TA        Ta         a TG        Ac       t  t CG       G  a      g  a A  |      A  a       at TA       G  |       ta TG       G  |       ta TA        Aa        ta GT        Gc        gc CG       T  |       gc AT        Ct       g  t TA        Cg       t  g TA        Ag        cg Gc        Cg        at                         ttgttttttatttggatatataattaattttcaaaatcaattaaaatctttttagagaggatgatttatattgattcgaaatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG3815 Predicted membrane protein ... can be seen here     ..................................................................................................................