                                                                        Gene putatively regulated by attenuation in B_anthracis_Ames

This operon is putativelly rgulated by Methionine_S-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:159 nt.    Distance to gene:27 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-18.00 kcal/mol
Antiterminator:    Distance from promoter:127 nt. Size=43 nt.     Delta G= -9.10 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgact-tagaat. It has a score value of 80.99 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgacttttatttgaaatgaacttagaatgaatgtaatttaatataattttatgaaaattcttatcacgagaggtggagggactggccctatgaaacctc
ggcagcggattcgttatgaatactgtgccaattccagcaaggtaacttgaaagataagaaagaagctcattttgactatatatacagaagcctctttcta
tcttttagaaagaggcttttttacgtgaaaataaaaggaggaagaaaaATG

    BA3206 Gene: BA3206     GI: 30263139     BI number: BA3206     GOG: COG1473     Description: peptidase, M20/M25/M40 famil ta a  t t  a c  t a  a gc ta tg ta         t t  |      c  t a  |      t  t c  |       at ta        ta cg        cg gc        ta a  c       ta at        ta gc        cg at        ta at        cg at        cg gc        gc at        at             tttttacgtgaaaataaaaggaggaagaaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG1473 Metal-dependent amidase/aminoacylase/carboxypeptidase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Methionine_S-box sequence ... can be seen here     ..................................................................................................................