                                                                        Gene putatively regulated by attenuation in B_anthracis_Ames

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:155 nt.    Distance to gene:34 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G= -9.10 kcal/mol
Antiterminator:    Distance from promoter:93 nt. Size=72 nt.     Delta G= -9.76 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAGA-TACACT. It has a score value of 62.92 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAGAGAACTGCTTCGATCTGACTACACTGACGAGGAAATAACAGATGTCGTACGCG
ACATATGGAACAACCGAGAAGATCGTTATTCAGATGAACGGTTAAGTAATAGTAATAA
AAAAGCTATGCCTAAAATTGAAATGTCACATATCGGTGGTTAAtataaagttgacataaaagtgaaaa
atggaaggtgtacaagaattgtagattttctattttatagtaaaagtgatgattgatctctctgtaaaagATG

   ق --- moeA --- 2 --- moaE --- 2 --- moaD Gene: BA3626     GI: 30263517     BI number: BA3626     GOG: -------     Description: hypothetical protein Gene: BA3625     GI: 30263516     BI number: BA3625     GOG: COG2116     Description: formate transporter, putative Gene: BA3624     GI: 30263515     BI number: BA3624     GOG: -------     Description: molybdopterin biosynthesis protein MoeB, putative Gene: moeA-2     GI: 30263514     BI number: BA3623     GOG: COG0303     Description: molybdopterin biosynthesis protein MoeA Gene: moaE-2     GI: 30263513     BI number: BA3622     GOG: COG0314     Description: molybdopterin converting factor, subunit 2 Gene: moaD-2     GI: 30263512     BI number: BA3621     GOG: -------     Description: molybdopterin converting factor, subunit   a t  a a  a tg At At Tg Ta Gc G  a T  t G  a G  a C  a T  a A  | T  | A  | Cg At Cg Ta G  a T  a A  |        a A  |      g  a A  |       at G  |       at Ta        cg Ta        at At        ta A  g      g  g A  g       ta A  a       gt Ta        gt Cg        at Cg        at Gt        gc Tg        gt At        ta             ttttatagtaaaagtgatgattgatctctctgtaaaagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG2116 Formate/nitrite family of transporters ... can be seen here [H] COG0303 Molybdopterin biosynthesis enzyme ... can be seen here [H] COG0314 Molybdopterin converting factor, large subunit ... can be seen here     ..................................................................................................................