                                                                        Gene putatively regulated by attenuation in B_anthracis_Ames

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:126 nt.    Distance to gene:39 nt.     Distance to run of Ts=0 nt.   Size=21 nt.     Delta G=-11.60 kcal/mol
Antiterminator:    Distance from promoter:95 nt. Size=42 nt.     Delta G= -7.90 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAAA-GAAGAT. It has a score value of 66.27 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAAAAAGCTGGCGAGATTACAGAAGATGATTTAAGAGGATATACTGAAGATATCCA
AAAAGAAACAGATAAATATATTGCAAAAGTTGACGAAATCGCAAAAAACAAAGAAAAA
GAAATCATGGAAGTGTAAtagcgataccttcgcaaatatgaccctcttcttaagggggtctttttacacttttaggcatacgtctgc
ttgctggagggtatgaATG

   ق --- dxr --- BA3958 --- 2 Gene: uppS     GI: 30263827     BI number: BA3961     GOG: COG0020     Description: undecaprenyl diphosphate synthase Gene: cdsA     GI: 30263826     BI number: BA3960     GOG: COG0575     Description: phosphatidate cytidylyltransferase Gene: dxr-2     GI: 30263825     BI number: BA3959     GOG: COG0743     Description: 1-deoxy-D-xylulose 5-phosphate reductoisomerase Gene: BA3958     GI: 30263824     BI number: BA3958     GOG: COG0750     Description: membrane-associated zinc metalloprotease, putativ   c a  c t  t at gc cg gc |  a |  a |  a at ta At A  g        t Ta       c  t Gc        ta |  c       ta |  c       cg T  t       tg Gc        cg At        cg At        cg Gc        at Gt        gc             tttttacacttttaggcatacgtctgcttgctggagggtatgaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [I] COG0020 Undecaprenyl pyrophosphate synthase ... can be seen here [I] COG0575 CDP-diglyceride synthetase ... can be seen here [I] COG0743 1-deoxy-D-xylulose 5-phosphate reductoisomerase ... can be seen here [M] COG0750 Predicted membrane-associated Zn-dependent proteases 1 ... can be seen here     ..................................................................................................................