                                                                        Gene putatively regulated by attenuation in B_anthracis_Ames

This operon is putativelly rgulated by Methionine_S-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:179 nt.    Distance to gene:43 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-13.10 kcal/mol
Antiterminator:    Distance from promoter:151 nt. Size=38 nt.     Delta G=-11.90 kcal/mol
Anti-antiterminator:    Distance from promoter:120 nt.    Size=48 nt.     Delta G= -8.82 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttggta-taaaaa. It has a score value of 60.24 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttggtatagtcttcaacataaagttaaaaattctaaaaaattatacaactcttatcaagagcaggtggagggatttggcccgatgaagcccagcaaccga
ccgtaataccattgtgaaatggggcgtttatgacgccaaaaggcacggtgctaattccagcagaaagtaaaactttctggcagataagaggggagaagat
aaacttcaaacctctttcttagtggaaagaggtttttctacgtcagaaaaacctctgaatgaaaaaagggggagaagacgATG

    BA4252 --- BA4251 Gene: BA4252     GI: 30264110     BI number: BA4252     GOG: COG4857     Description: 5-methylthioribose kinase, putative Gene: BA4251     GI: 30264109     BI number: BA4251     GOG: COG0182     Description: translation initiation factor, putative, aIF-2BI famil   a a  a t  a gc at at at gc at cg         a |  g      t  a |  c      a  a |  a       gc |  g       at |  a       at |  t       gc |  a      a  a |  a      g  a       ag |  g      g  a      t  t g  a       gc        tg a  g       gc        cg cg        at        ta cg        gc        ta tg        at        ta ta        at        cg a  g      t  |       ta a  a       at        cg ta        gc        cg cg        at        at                         ttttctacgtcagaaaaacctctgaatgaaaaaagggggagaagacgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG4857 Predicted kinase ... can be seen here [J] COG0182 Predicted translation initiation factor 2B subunit, eIF-2B alpha/beta/delta family ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Methionine_S-box sequence ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_anthracis_Ames This operon is putativelly rgulated by Methionine_S-box                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:157 nt.    Distance to gene:62 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G= -7.80 kcal/mol Antiterminator:    Distance from promoter:124 nt. Size=41 nt.     Delta G= -7.84 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: ttggta-taaaaa. It has a score value of 60.24 and is shown in blue Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ttggtatagtcttcaacataaagttaaaaattctaaaaaattatacaactcttatcaagagcaggtggagggatttggcccgatgaagcccagcaaccga ccgtaataccattgtgaaatggggcgtttatgacgccaaaaggcacggtgctaattccagcagaaagtaaaactttctggcagataagaggggagaagat aaacttcaaacctctttcttagtggaaagaggtttttctacgtcagaaaaacctctgaatgaaaaaagggggagaagacgATG     BA4252 --- BA4251 Gene: BA4252     GI: 30264110     BI number: BA4252     GOG: COG4857     Description: 5-methylthioribose kinase, putative Gene: BA4251     GI: 30264109     BI number: BA4251     GOG: COG0182     Description: translation initiation factor, putative, aIF-2BI famil   a a  a t  a gc at at at gc at cg |  g |  c |  a        a |  g      t  a |  a      a  a |  t       gc |  a       at |  a       at |  g       gc |  a      a  a g  g      g  a a  g      g  a cg        gc cg        gc ta        at tg        gc             tttcttagtggaaagaggtttttctacgtcagaaaaacctctgaatgaaaaaagggggagaagacgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG4857 Predicted kinase ... can be seen here [J] COG0182 Predicted translation initiation factor 2B subunit, eIF-2B alpha/beta/delta family ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Methionine_S-box sequence ... can be seen here     ..................................................................................................................